Test strip for rapid detection of brucella
A technology of Brucella and test strips, applied in the field of Brucella colloidal gold rapid detection test strips, can solve atypical clinical symptoms, misdiagnosis, and lack of details, especially medical history, contact history, occupation, diet Habits, living areas and popular areas, etc., to achieve the effect of industrialization, preservation and transportation convenience
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1: Preparation of Brucella outer membrane protein bp26 genetic engineering antigen
[0034] (1) Acquisition of target gene
[0035] According to the target gene fragment sequence (GenBank accession number is AY166769) and the characteristics of pGEX-4T-1 (Pharmacia) expression vector, primers containing restriction enzymes EcoR1 and Xho1 are designed at both ends:
[0036] 5’gaattcatgaacactcgtgct3’
[0037] 5’gcctcgagttacttgatttcaa3’
[0038] Then, the target gene fragment bp26 was amplified from the Brucella genome, and the amplification conditions were: denaturation at 95°C for 5 min; 95°C for 1 min, 49.8°C for 1 min, and 70°C for 1 min for 35 cycles; finally, extension at 70°C for 10 min.
[0039] (2) Cloning of target gene and screening of positive recombinants
[0040] The PCR amplified product was gelled and recovered after electrophoresis. After being ligated with PMD-18T cloning vector overnight at 16°C, it was transformed into DH5α competent cells. The mono...
Embodiment 2
[0048] Example 2: Preparation of monoclonal antibody against Brucella outer membrane protein bp26
[0049] (1) Immunize mice
[0050] After the prepared genetically engineered antigen was taken out of the -20 low-temperature refrigerator and dissolved, it was injected subcutaneously (0.2 ml / mouse) into the back of BALB / C mice with an interval of 10 days. Three days before the fusion, the mice were challenged with 0.15 ml of antigen in the abdominal cavity. The immune effect was tested by ELISA method.
[0051] (2) Myeloma cells
[0052] SP2 / 0 myeloma cells: purchased from the Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences. Resuscitate the SP2 / 0 cells stored in the liquid nitrogen tank and culture them in DMEM medium containing 10% calf serum for 48-72 hours. When the cells grow well, the cells are round, bright, uniform in size, neatly arranged, and aligned. The number is divided, ready to merge.
[0053] (3) Cell fusion
[0054] The prepared SP2 / 0 ...
Embodiment 3
[0061] Example 3: Assay of monoclonal antibody against Brucella outer membrane protein bp26
[0062] (1) Preparation of monoclonal antibody ascites:
[0063] Mice: SPF mice, no murine virus contamination after inspection, if the animal is found to be unhealthy, bitten, or infected during the ascites production process, it should be discarded.
[0064] Cell line expansion culture: Take 1 production batch cell tube to resuscitate, add nutrient solution to expand culture, 1 production cell is only used once, no longer frozen.
[0065] Hybridoma cell line inoculation: The preparation of ascites should be carried out under aseptic conditions. Before injecting hybridoma cells, each mouse is intraperitoneally injected with liquid paraffin 0.5ml. One week later, each mouse was intraperitoneally injected with hybridoma cells 1-3×10 6 / 0.2ml.
[0066] Ascites collection: 7-10 days after injection of the cell line, or ascites collected once before the mouse is dying, and stored at -20°C.
[...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
