Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test strip for rapid detection of brucella

A technology of Brucella and test strips, applied in the field of Brucella colloidal gold rapid detection test strips, can solve atypical clinical symptoms, misdiagnosis, and lack of details, especially medical history, contact history, occupation, diet Habits, living areas and popular areas, etc., to achieve the effect of industrialization, preservation and transportation convenience

Inactive Publication Date: 2009-02-11
BEIJING ZHUANGDI HAOHE BIOMEDICINE SCI & TECH
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main reasons for long-term misdiagnosis are as follows: (1) Insufficient understanding of brucellosis by clinicians is the main reason for misdiagnosis
(2) The epidemiological information is not detailed, especially the medical history, contact history, occupation, eating habits, living area and endemic area, etc.
(3) Diversified clinical manifestations and atypical clinical symptoms
(4) Lack of simple, rapid, specific and sensitive detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test strip for rapid detection of brucella
  • Test strip for rapid detection of brucella
  • Test strip for rapid detection of brucella

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Preparation of Brucella outer membrane protein bp26 genetic engineering antigen

[0034] (1) Acquisition of target gene

[0035] According to the target gene fragment sequence (GenBank accession number is AY166769) and the characteristics of pGEX-4T-1 (Pharmacia) expression vector, primers containing restriction enzymes EcoR1 and Xho1 are designed at both ends:

[0036] 5’gaattcatgaacactcgtgct3’

[0037] 5’gcctcgagttacttgatttcaa3’

[0038] Then, the target gene fragment bp26 was amplified from the Brucella genome, and the amplification conditions were: denaturation at 95°C for 5 min; 95°C for 1 min, 49.8°C for 1 min, and 70°C for 1 min for 35 cycles; finally, extension at 70°C for 10 min.

[0039] (2) Cloning of target gene and screening of positive recombinants

[0040] The PCR amplified product was gelled and recovered after electrophoresis. After being ligated with PMD-18T cloning vector overnight at 16°C, it was transformed into DH5α competent cells. The mono...

Embodiment 2

[0048] Example 2: Preparation of monoclonal antibody against Brucella outer membrane protein bp26

[0049] (1) Immunize mice

[0050] After the prepared genetically engineered antigen was taken out of the -20 low-temperature refrigerator and dissolved, it was injected subcutaneously (0.2 ml / mouse) into the back of BALB / C mice with an interval of 10 days. Three days before the fusion, the mice were challenged with 0.15 ml of antigen in the abdominal cavity. The immune effect was tested by ELISA method.

[0051] (2) Myeloma cells

[0052] SP2 / 0 myeloma cells: purchased from the Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences. Resuscitate the SP2 / 0 cells stored in the liquid nitrogen tank and culture them in DMEM medium containing 10% calf serum for 48-72 hours. When the cells grow well, the cells are round, bright, uniform in size, neatly arranged, and aligned. The number is divided, ready to merge.

[0053] (3) Cell fusion

[0054] The prepared SP2 / 0 ...

Embodiment 3

[0061] Example 3: Assay of monoclonal antibody against Brucella outer membrane protein bp26

[0062] (1) Preparation of monoclonal antibody ascites:

[0063] Mice: SPF mice, no murine virus contamination after inspection, if the animal is found to be unhealthy, bitten, or infected during the ascites production process, it should be discarded.

[0064] Cell line expansion culture: Take 1 production batch cell tube to resuscitate, add nutrient solution to expand culture, 1 production cell is only used once, no longer frozen.

[0065] Hybridoma cell line inoculation: The preparation of ascites should be carried out under aseptic conditions. Before injecting hybridoma cells, each mouse is intraperitoneally injected with liquid paraffin 0.5ml. One week later, each mouse was intraperitoneally injected with hybridoma cells 1-3×10 6 / 0.2ml.

[0066] Ascites collection: 7-10 days after injection of the cell line, or ascites collected once before the mouse is dying, and stored at -20°C.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a quick test dipstick used for testing a specific antigen of Brucella, which comprises a reaction membrane and a binder release liner. The reaction membrane is provided with a testing strap coated with a bp26 monoclonal antibody or bp26 polyclonal antibody and a quality control strap coated with anti-IgG; the binder release liner is coated with the bp26 monoclonal antibody which is marked by colloidal gold to be different from an antigen binding site on the reaction membrane. A membrane chromatography double antibody sandwich method is applied for detecting the specific antigen of the Brucella in a specimen. As the dipstick is adopted for test, the operation is simple, convenient, quick and concise, requiring no special equipment and facilities as well as professional training. Furthermore, the dipstick has clear and easy-identity results, simple operation and easy popularization, is applicable to matrixes, field tests of emergency on a large scale and the study of epidemiology and can aid in the infection diagnostics of the Brucella.

Description

Technical field [0001] The invention belongs to the field of biological detection, and relates to the preparation of the Brucella outer membrane protein bp26 genetic engineering antigen and the development of its monoclonal antibody, and the Brucella colloidal gold rapid detection test strip containing the monoclonal antibody and its application . technical background [0002] Brucellosis is a zoonotic infectious disease caused by Brucella, commonly known as wave fever. The clinical features include long-term fever, hyperhidrosis, joint pain, fatigue, hepatosplenomegaly, etc. This disease is prevalent in various countries in the world. [0003] Humans are mainly infected through skin, mucous membranes, digestive tract and respiratory tract, especially Brucella melitensis and Brucella bovis are the most serious. Brucella suis is less common in humans, and Brucella canis is rare to infect humans. Brucella ovine epididymis and Brucella gerbils basically do not infect humans. [0004...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/12C12N15/31C12N15/63C07K14/23G01N33/577G01N33/558
Inventor 刘明
Owner BEIJING ZHUANGDI HAOHE BIOMEDICINE SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com