Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of a carbonyl reductase in the production of ethyl (s)-4-chloro-3-hydroxybutyrate

A technology of ethyl hydroxybutyrate and carbonyl reductase, which is applied in the direction of oxidoreductase, fermentation, etc., to achieve the effects of reducing production costs, high yield, and high optical activity

Inactive Publication Date: 2011-11-30
NANJING TECH UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no report has been found that this carbonyl reductase is used for the asymmetric reduction of COBE to prepare (S)-CHBE

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a carbonyl reductase in the production of ethyl (s)-4-chloro-3-hydroxybutyrate
  • Application of a carbonyl reductase in the production of ethyl (s)-4-chloro-3-hydroxybutyrate
  • Application of a carbonyl reductase in the production of ethyl (s)-4-chloro-3-hydroxybutyrate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Construction of recombinant Escherichia coli E.coli Rosseta (pET22b-PsCR)

[0027] 1. Acquisition of carbonyl reductase gene

[0028] Pichia Stipitis CBS 6054 (purchased from Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversiry Centre), medium YPD (g L -1 ): Yeast extract 10g, peptone 20g, glucose 20g, add distilled water to 1L.

[0029] Pichia Stipitis CBS 6054 was inoculated in 5mL LYPD liquid medium and cultured at 30°C to logarithmic growth phase, and the genome was extracted using a genomic DNA extraction kit (Beijing Tianwei Bioengineering Co., Ltd. Yeast Genome Extraction Kit).

[0030] The primers used to construct the expression vectors are provided with enzyme cutting sites, and the primer sequences are as follows:

[0031] The upstream primer (CR-sense contains Nde I) is: 5'GGAATTC CATATG ACCAACAACCCGAGCAT

[0032] The downstream primer (CR-anti contains BamHI) is: CGC GGATCC CTATGGCGCACAGTAGCCTCC

[0033] All primers were synthes...

Embodiment 2

[0042] Embodiment 2: Fermentation of recombinant Escherichia coli E.coli Rosseta (pET22b-PsCR)

[0043] Pick the recombinant bacteria E.coli Rosseta (pET-22b-PsCR) into the LB culture medium containing antibiotics, and cultivate overnight at 37°C with shaking. Then inoculate into fresh culture medium according to 2% inoculum amount, and cultivate to OD at 37°C 600 At about 0.6, add IPTG to a final concentration of 0.8 mmol.L -1 , 25°C, 220rpm, after induction of expression for 10h, centrifuge at 8000rpm, 4°C for 10min, discard the supernatant, and precipitate for later use.

Embodiment 3

[0045] Get the precipitate of Example 2 and wash twice with potassium phosphate buffer (100mmol L-1, pH6.5), weigh 0.5g (wet weight) of Escherichia coli sludge, and suspend in 15mL of pH6.5 potassium phosphate buffer . Cells were sonicated (power 300W, sonication 5s, intermittent 5s, 5min in total), glucose 200mmol / L, COBE 1.5g / L, GDH50U, NADP 0.05mmol / L, 20°C, 180rpm, 16h. The yield of the product (S)-CHBE was 1.45 g / L, the yield of the product was: 96.7%, and the optical purity e.e% was 100%.

[0046] The detection method of product is as follows (the detection method of product is identical with embodiment 3 in the following examples):

[0047] For the aqueous phase reaction: after the reaction, add an equal volume of ethyl acetate, vibrate vigorously for 10 minutes, then place it for two hours, and centrifuge at 8000rpm for 10 minutes to separate the organic layer and the aqueous layer. Carefully draw the upper layer of ethyl acetate through the organic membrane, add the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for preparing ethyl (S)-4-chloro-3-hydroxybutanoate ((S)-CHBE) through asymmetric reduction from ethyl 4-chloroacetoacetate (COBE), in which the catalyst is carbonyl reductase having amino acid sequence shown in SEQ ID NO: 2 from Pichia stipitis, the cofactor is NADPH, the conversion ratio for the substrate is more than 95%, and the optical purity of product is 100% enantiomeric excess.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of a carbonyl reductase, in particular to a carbonyl reductase (Ccarbonyl Rreductase CR) used in the asymmetric reduction reaction of ethyl 4-chloroacetoacetate to produce (S) - Application of ethyl 4-chloro-3-hydroxybutyrate. Background technique [0002] (S)-4-chloro-3-hydroxybutanoate (Ethyl 4-chloro-3-hydroxybutanoate, (S)-CHBE) is an important organic intermediate, which can be used in the synthesis of many active drugs, such as statins Drugs - hydroxymethylglutaryl CoA (HMG-CoA) reductase inhibitors and 4-hydroxypyrrolidone (4-hydroxypyrrolidone), etc. [1]. [0003] 4-chloroacetoacetate ethyl COBE (4-chloroacetoacetate Ethyl COBE) is used as the hypochiral substrate of the reduction reaction, which is easy to synthesize and low in price. It is very economical to use it as a substrate for asymmetric reduction reaction to obtain (S)-CHBE effective preparation rout...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P7/62C12N9/02
CPCC12P7/42C12N9/0004
Inventor 应汉杰严明叶齐许琳熊健柏建新陈勇李振江
Owner NANJING TECH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More