Novel antibacterial peptide and preparation method and use thereof
A technology for antimicrobial peptides and Rana japonica, which is applied to the application fields of antimicrobial peptides and their preparation methods and pharmaceuticals, can solve the problems of less research on molecular structure and genetic effects, and the inability of antimicrobial peptides to be used clinically.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Cloning of antimicrobial peptide temporin-1CEa gene preprotemporin-1CEa
[0042] 1. Design of primers
[0043] According to the amino acid sequence of the N-terminal signal peptide of the frog skin antimicrobial peptide gene precursor in GenBank, a 3′RACE gene-specific primer GSP1: 5′-ATGTTCACCTTGAAGAAATCCCTG-3′, 3′RACE Outer Primer: TACCGTCGTTCCACTAGTGATTT, 3′ was designed and synthesized RACE Inner Primer: CGCGGATCCTCCACTAGTGATTTCACTATAGG, the primer was synthesized by Japan TaKaRa Dalian Company.
[0044] 2. cDNA cloning of antimicrobial peptide gene
[0045] (1) Extraction of total RNA from the skin of Rana chinensis: the back skin of Rana chinensis was taken and freeze-dried in liquid nitrogen. Weigh 300 mg of freeze-dried skin, add 10 mL of RNAiso solution, and homogenize at 0°C for 30 minutes; add an equal volume of phenol / chloroform solution to the homogenate, shake vigorously for about 10 minutes, and centrifuge (12,000 rpm, 4°C) for 10 minutes to remove prot...
Embodiment 2
[0079] Preparation of antimicrobial peptide temporin-1CEa by genetic engineering
[0080] 1. Synthetic genes
[0081] 1. Production of DNA fragments
[0082]The DNA fragment of the target sequence is (molecular weight: 51bp): 5'-TTTGTAGATTTGAAAAAGATTGCAAATATTATCAATTCTATATTTGGAAAA-3'. A methionine codon ATG is added to the 5' end of the target sequence to form a 54bp DNA fragment. After 6 times of tandem ligation, a stop codon TAA was added at the 3' end, and finally two restriction sites were added at the 5' and 3' ends: SmaI / HindIII, with a total length of 339bp. Synthesize 339bp single-stranded small fragment DNA, and then use PCR method to splice the single-stranded small fragment DNA into a complete double-stranded DNA fragment, called T6AMP gene, see figure 2 . The PCR program was as follows: 94°C for 3min, 94°C for 30s, 55°C for 30s, 72°C for 1min, a total of 30 cycles, and 72°C for 10min.
[0083] 2. Connection and conversion
[0084] Add 2 μl T6AMP DNA (about 20...
Embodiment 3
[0101] Solid Phase Synthesis of Antimicrobial Peptide temporin-1CEa from Rana chinensis
[0102] According to the standard Fmoc solid-phase peptide synthesis procedure, the Chinese Rana antimicrobial peptide was artificially synthesized: temporin-1CEa (PheValAspLeuLysLysIleAlaAsnIleIleAsnSerIlePhe-AMIDATION) was purified by reverse-phase HPLC (Vydac 218TP1022 column 2.2cm×25cm), using acetonitrile / water / trifluoroacetic acid system Elution, MALDI-TOF and EPI mass spectrometry. Antimicrobial peptide synthesis was completed by SBS Genetech Co., Ltd. Beijing, China.
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap