Check patentability & draft patents in minutes with Patsnap Eureka AI!

Novel antibacterial peptide and preparation method and use thereof

A technology for antimicrobial peptides and Rana japonica, which is applied to the application fields of antimicrobial peptides and their preparation methods and pharmaceuticals, can solve the problems of less research on molecular structure and genetic effects, and the inability of antimicrobial peptides to be used clinically.

Inactive Publication Date: 2009-04-29
LIAONING NORMAL UNIVERSITY
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Antimicrobial peptides have gone through a long period of time from discovery to topical use, but there are few studies on their molecular structure and genetic effects, making most antimicrobial peptides unable to be used clinically

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel antibacterial peptide and preparation method and use thereof
  • Novel antibacterial peptide and preparation method and use thereof
  • Novel antibacterial peptide and preparation method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Cloning of antimicrobial peptide temporin-1CEa gene preprotemporin-1CEa

[0042] 1. Design of primers

[0043] According to the amino acid sequence of the N-terminal signal peptide of the frog skin antimicrobial peptide gene precursor in GenBank, a 3′RACE gene-specific primer GSP1: 5′-ATGTTCACCTTGAAGAAATCCCTG-3′, 3′RACE Outer Primer: TACCGTCGTTCCACTAGTGATTT, 3′ was designed and synthesized RACE Inner Primer: CGCGGATCCTCCACTAGTGATTTCACTATAGG, the primer was synthesized by Japan TaKaRa Dalian Company.

[0044] 2. cDNA cloning of antimicrobial peptide gene

[0045] (1) Extraction of total RNA from the skin of Rana chinensis: the back skin of Rana chinensis was taken and freeze-dried in liquid nitrogen. Weigh 300 mg of freeze-dried skin, add 10 mL of RNAiso solution, and homogenize at 0°C for 30 minutes; add an equal volume of phenol / chloroform solution to the homogenate, shake vigorously for about 10 minutes, and centrifuge (12,000 rpm, 4°C) for 10 minutes to remove prot...

Embodiment 2

[0079] Preparation of antimicrobial peptide temporin-1CEa by genetic engineering

[0080] 1. Synthetic genes

[0081] 1. Production of DNA fragments

[0082]The DNA fragment of the target sequence is (molecular weight: 51bp): 5'-TTTGTAGATTTGAAAAAGATTGCAAATATTATCAATTCTATATTTGGAAAA-3'. A methionine codon ATG is added to the 5' end of the target sequence to form a 54bp DNA fragment. After 6 times of tandem ligation, a stop codon TAA was added at the 3' end, and finally two restriction sites were added at the 5' and 3' ends: SmaI / HindIII, with a total length of 339bp. Synthesize 339bp single-stranded small fragment DNA, and then use PCR method to splice the single-stranded small fragment DNA into a complete double-stranded DNA fragment, called T6AMP gene, see figure 2 . The PCR program was as follows: 94°C for 3min, 94°C for 30s, 55°C for 30s, 72°C for 1min, a total of 30 cycles, and 72°C for 10min.

[0083] 2. Connection and conversion

[0084] Add 2 μl T6AMP DNA (about 20...

Embodiment 3

[0101] Solid Phase Synthesis of Antimicrobial Peptide temporin-1CEa from Rana chinensis

[0102] According to the standard Fmoc solid-phase peptide synthesis procedure, the Chinese Rana antimicrobial peptide was artificially synthesized: temporin-1CEa (PheValAspLeuLysLysIleAlaAsnIleIleAsnSerIlePhe-AMIDATION) was purified by reverse-phase HPLC (Vydac 218TP1022 column 2.2cm×25cm), using acetonitrile / water / trifluoroacetic acid system Elution, MALDI-TOF and EPI mass spectrometry. Antimicrobial peptide synthesis was completed by SBS Genetech Co., Ltd. Beijing, China.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a new antibiosis peptide and a preparation method and application thereof, which belongs to the field of antibiosis peptide and preparation. According to the invention, the temporin-1CEa gene of the new antibiosis peptide is cloned from the total RNA of the skin of rana temporaria chensinensis; and all the DNA sequences are shown in a sequence list. The No.144 to No.192 nucleotides in the gene are encoded as temporin-1CEa; the total sequence is Phe Val Asp Leu Lys Lys Ile Ala Asn Ile Ile Asn Ser Ile Phe-AMIDATION; and the molecular weight is 1733 Daltons. The antibiosis peptide temporin-1CEa which can be prepared through an amino acid synthesizer or a genetic engineering method has remarkable antibiosis and anticancer activity and no haematolysis on the erythrocytes of a mammal, and can be used for preparing antibiosis and anticancer medicines.

Description

technical field [0001] The invention belongs to the field of antimicrobial peptides and preparation thereof, in particular to an antimicrobial peptide encoded by Rana sinensis gene with antibacterial and anticancer activities, a preparation method and application in pharmaceuticals. Background technique [0002] In the past ten years, the widespread use of antibiotics has led to the resistance of many bacteria and viruses to existing antibiotics. The spread of drug-resistant pathogenic strains has caused the rapid decline or even disappearance of the efficacy of antibiotics. Therefore, searching for new antibiotics that kill pathogenic microorganisms with a new mechanism and are not easy to develop drug resistance has become one of the current research hotspots. [0003] Antimicrobial peptide is a kind of small molecular polypeptide with broad-spectrum antibacterial activity induced by organisms. It is generally composed of 20-60 amino acids and has a molecular weight of abo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K7/08C12N15/12C12N15/70C12N1/19A61K38/10A61P31/00A61P35/00C12R1/19
Inventor 尚德静
Owner LIAONING NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More