Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sea actinomycete with antifungal activity and use thereof

A marine actinomycetes and antifungal technology, applied in the direction of application, bacteria, fungicides, etc., can solve the problems of severe drug resistance of fungi, recurrence and increase of clinical treatment, etc., achieve long-lasting drug effect, strong antifungal activity, good The effect of the resistance effect

Inactive Publication Date: 2009-05-06
SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the widespread use of azole drugs, fungal drug resistance is becoming more and more serious, and the number of cases of recurrence or even failure of clinical treatment has increased in large numbers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sea actinomycete with antifungal activity and use thereof
  • Sea actinomycete with antifungal activity and use thereof
  • Sea actinomycete with antifungal activity and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The luxuriant film sponge sample that my country's Yellow Bohai Sea Dalian sea area collects, cultivates in the laboratory by following conditions, can get marine actinomycetes of the present invention alive:

[0019] The marine actinomycetes described in the present invention is based on the phylogenetic analysis of its morphological characteristics, cell wall chemical components and 16SrRNA gene sequence. The full sequence of the 16SrRNA gene of the bacterium is as follows:

[0020] It has the base sequence of SEQ ID No: 1 in the sequence table.

[0021] SEQ ID No: 1:

[0022] 1 GTGCTTAACACATGCAAGTCGAACGATGAACCGCTTTCGGGCGGGGATTA

[0023] 51 GTGGCGAACGGGTGAGTAACACGTGGGCAATCTGCCCTGCACTCTGGGAC

[0024] 101 AAGCCCTGGAAACGGGGTCTAATACCGGATATGACCGTCTGCCGCATGGT

[0025] 151 GGATGGTGTAAAGCTCCGGCGGTGCAGGATGAGCCCGCGGCCTATCAGCT

[0026] 201 TGTTGGTGAGGTAGTGGCTCACCAAGGCGACGACGGGTAGCCGGCCTGAG

[0027] 251 AGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGA

[0028] 301 GGCAGCA...

Embodiment 2

[0062] The antibacterial activity analysis of the fermented liquid produced by marine actinomycetes of the present invention:

[0063] Spread the bacterial suspension of the indicator bacteria on a suitable medium (Candida albicans is spread on Sabouraud medium, Magnaporthe grisea and Fusarium oxysporum are spotted on potato medium, bacteria are spread on Beef extract peptone medium), place the Oxford cup.

[0064] The fermented liquid produced by the marine actinomycetes of the present invention is centrifuged at 5000rpm for 3min, and 290 μl of the supernatant is added dropwise in an Oxford cup, cultivated at a suitable temperature (bacteria are cultivated at 37°C, fungi are cultivated at 28°C), and the antibacterial effect is observed. The size of the circle. Such as figure 2 As shown, A. is the result of resistance to Candida albicans, B is the result of resistance to Pyricularia oryzae, and C is the result of resistance to Fuarium oxysporum.

Embodiment 3

[0066] Stability analysis of marine actinomycetes fermented liquid antifungal substance of the present invention:

[0067] Adjust the fermentation filtrate produced by Streptomyces griseus according to the present invention to pH 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 respectively with 1mol / L of HCl and NaOH and place them at room temperature for treatment 1h, 30°C, 40°C, 50°C treatment for 20min, using Candida albicans as the indicator bacteria to measure the antibacterial activity, respectively using the same pH buffer as the control. (pH2.0-8.0 uses disodium hydrogen phosphate-citric acid buffer solution, pH9.0-10.0 uses glycine-sodium hydroxide buffer solution).

[0068] As shown in Table 4, the value is the diameter of the inhibition zone (in mm), 1 is room temperature (25°C) for 1 hour; 2 is 30°C for 20 minutes; 3 is 40°C for 20 minutes; 4 is 50°C for 20 minutes minutes; 5 is the control (corresponding pH buffer control group)

[0069] Table 4 is the stability te...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of marine microorganism as well as prevention and treatment of fungal disease of animals and plants, in particular to marine actinomycete with antifungal activity and application thereof, The marine actinomycete is a strain of a Streptomyces griseus genus and is preserved in China center for type culture collection in April 13, 2007; the CCTCC NO is M 207046; and the diagnostic characteristic is named Streptomyces griseus Hmp-S19. The zymotic fluid of the strain has the functions of resisting Candida albicans, Pyricularia o ryzae, Fuarium oxysporum and other pathogenic fungi, and has stable and lasting effect and huge potential for developing a novel, high-efficient, nontoxic, natural, agricultural and medical drug.

Description

technical field [0001] The present invention relates to the application of marine microorganisms and the prevention and treatment of animal and plant fungal diseases, specifically a kind of anti-candida albicans (Candida albicans), rice blast mold (Pyricularia oryzae) and oxysporum (Fuarium oxysporum) etc. Marine microorganisms of pathogenic fungi. Background technique [0002] Rice blast, also known as rice fever and pinch-neck blast, is an important disease in various rice-producing areas in the world. Rice blast occurs in the north and south rice regions of my country, and is listed as the first of the three major diseases of rice. The epidemic year of the disease generally reduces production by 10% to 20%, serious 50%, or even more than 80%. Magnaporthe grisea is the pathogen of rice blast. In the 1950s and 1960s, the use of chemical agents to control rice blast caused great harm to rice and humans. Since the 1970s, people began to use green biological pesticides to co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/02A01P3/00C12R1/545
Inventor 刘丽胡江春马成新薛德林王书锦
Owner SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com