Sea actinomycete with antifungal activity and use thereof
A marine actinomycetes and antifungal technology, applied in the direction of application, bacteria, fungicides, etc., can solve the problems of severe drug resistance of fungi, recurrence and increase of clinical treatment, etc., achieve long-lasting drug effect, strong antifungal activity, good The effect of the resistance effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] The luxuriant film sponge sample that my country's Yellow Bohai Sea Dalian sea area collects, cultivates in the laboratory by following conditions, can get marine actinomycetes of the present invention alive:
[0019] The marine actinomycetes described in the present invention is based on the phylogenetic analysis of its morphological characteristics, cell wall chemical components and 16SrRNA gene sequence. The full sequence of the 16SrRNA gene of the bacterium is as follows:
[0020] It has the base sequence of SEQ ID No: 1 in the sequence table.
[0021] SEQ ID No: 1:
[0022] 1 GTGCTTAACACATGCAAGTCGAACGATGAACCGCTTTCGGGCGGGGATTA
[0023] 51 GTGGCGAACGGGTGAGTAACACGTGGGCAATCTGCCCTGCACTCTGGGAC
[0024] 101 AAGCCCTGGAAACGGGGTCTAATACCGGATATGACCGTCTGCCGCATGGT
[0025] 151 GGATGGTGTAAAGCTCCGGCGGTGCAGGATGAGCCCGCGGCCTATCAGCT
[0026] 201 TGTTGGTGAGGTAGTGGCTCACCAAGGCGACGACGGGTAGCCGGCCTGAG
[0027] 251 AGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGA
[0028] 301 GGCAGCA...
Embodiment 2
[0062] The antibacterial activity analysis of the fermented liquid produced by marine actinomycetes of the present invention:
[0063] Spread the bacterial suspension of the indicator bacteria on a suitable medium (Candida albicans is spread on Sabouraud medium, Magnaporthe grisea and Fusarium oxysporum are spotted on potato medium, bacteria are spread on Beef extract peptone medium), place the Oxford cup.
[0064] The fermented liquid produced by the marine actinomycetes of the present invention is centrifuged at 5000rpm for 3min, and 290 μl of the supernatant is added dropwise in an Oxford cup, cultivated at a suitable temperature (bacteria are cultivated at 37°C, fungi are cultivated at 28°C), and the antibacterial effect is observed. The size of the circle. Such as figure 2 As shown, A. is the result of resistance to Candida albicans, B is the result of resistance to Pyricularia oryzae, and C is the result of resistance to Fuarium oxysporum.
Embodiment 3
[0066] Stability analysis of marine actinomycetes fermented liquid antifungal substance of the present invention:
[0067] Adjust the fermentation filtrate produced by Streptomyces griseus according to the present invention to pH 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 respectively with 1mol / L of HCl and NaOH and place them at room temperature for treatment 1h, 30°C, 40°C, 50°C treatment for 20min, using Candida albicans as the indicator bacteria to measure the antibacterial activity, respectively using the same pH buffer as the control. (pH2.0-8.0 uses disodium hydrogen phosphate-citric acid buffer solution, pH9.0-10.0 uses glycine-sodium hydroxide buffer solution).
[0068] As shown in Table 4, the value is the diameter of the inhibition zone (in mm), 1 is room temperature (25°C) for 1 hour; 2 is 30°C for 20 minutes; 3 is 40°C for 20 minutes; 4 is 50°C for 20 minutes minutes; 5 is the control (corresponding pH buffer control group)
[0069] Table 4 is the stability te...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com