Method for quantitative detection of mycoplasma hyopneumoniae

A technology of Mycoplasma hyopneumoniae and a detection method, applied in the field of real-time fluorescent quantitative PCR primers and probes, can solve the problems of difficult Mhp accurate quantitative detection and the like

Inactive Publication Date: 2009-07-29
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In recent years, fluorescent quantitative PCR technology has been used to detect mycoplasma at home and abroad, but it is limite

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quantitative detection of mycoplasma hyopneumoniae
  • Method for quantitative detection of mycoplasma hyopneumoniae
  • Method for quantitative detection of mycoplasma hyopneumoniae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The establishment of embodiment 1Mhp TaqMan fluorescent quantitative PCR detection method

[0028] This example aims to use primers to p110realF / R and probes for quantitative PCR, and establishes a Mhp TaqMan fluorescent quantitative PCR detection method.

[0029] 1.1 Design and synthesis of primers and probes

[0030] According to the p110 (p76) gene sequence of Mycoplasma hyopneumoniae genome published on GenBank (ACCESSION No.NC_006360), the following fluorescent quantitative PCR primers and probes were designed using Primer Express v2.0 software.

[0031] P110realF: AGGATACAAACTGAGAAACCGAGCTA

[0032] P110realR: CAAGACCGAGTGGGTATGACCT

[0033] Probe: TGGACAGATCGGTGATACAACCCCACA

[0034] 1.2 Extraction of Mycoplasma hyopneumoniae genome

[0035] 1) Centrifuge 1ml Mhp Mycoplasma culture at 12000rpm room temperature for 10min, discard the supernatant;

[0036] 2) Add 300 μl proteinase K lysis buffer system (10 mM Tris-EDTA [pH=7.5], 0.5% [wt / vol] SDS, 100 μg / ml pr...

Embodiment 2

[0098] The specificity test of embodiment 2 Mycoplasma hyopneumoniae fluorescent PCR detection method

[0099] Common genetically engineered bacteria (Escherichia coli DH5α strain and BL21 strain), oral mycoplasma, and pathogens often mixed with Mycoplasma hyopneumoniae (porcine circovirus, PRRSV and mycoplasma hyorhina) were used as control samples, respectively. The standard plasmid was used as a positive control, and the sterilized DDW was used as a negative control to test the specificity of the fluorescent PCR detection method based on Mycoplasma hyopneumoniae.

[0100] 2.1 Experimental materials

[0101] For comparison, Mycoplasma orale CVCC 379 strains and Mycoplasma hyorhinis CVCC 361 strains were purchased from China Veterinary Drug Control Institute, and the others were laboratory-preserved strains.

[0102] 2.2 Sample pretreatment

[0103] 2.2.1 Acquisition of viral DNA

[0104] PRRSV RNA was extracted according to the instructions of Invitrogen Company. Oligo(d...

Embodiment 3

[0127] The sensitivity test of embodiment 3 Mycoplasma hyopneumoniae fluorescent PCR detection method

[0128] Make a 10-fold serial dilution of the standard plasmid containing the target gene whose copy number has been calculated to 10 copies / μl. Take the concentration as 10 6 、10 5 、10 4 、10 3 、10 2 、10 1 Copies / μl of the plasmid was used as a template for Real Time PCR. The lowest starting template concentration with product is the sensitivity of the Real Time PCR. According to the amplification curve analysis, the detection sensitivity of the Real Time PCR method is 10 copies / μl or 20 copies / 20 μl reaction system. See details figure 2 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Copy numberaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention provides a PCR primer for real-time fluorescent quantitative detection of Mycoplasma hyopneumoniae and a quantitative detection method thereof. The Mycoplasma hyopneumoniae is the main pathogen of swine enzootic pneumonia, is difficult to culture, and is difficult to detect quantitatively by microscope as the shape thereof is too small, and the traditional hyopneumoniae CCU detection and CFU detection have long time consumption, high pollution rate, different detection results due to different culture media, operation methods or criteria as well as difficult practical application. The real-time fluorescent quantitative PCR detection method established by the invention adopts the concentration-known standard plasmids containing target genes as reference, has the advantages of fast speed, high sensitivity and precise, and can be used for the quantitative or micro-detection of cultures of Mycoplasma hyopneumoniae and semi-finished products of vaccines.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and pathogen quantitative detection. Specifically, the present invention relates to real-time fluorescent quantitative PCR primers and probes for detecting Mycoplasma hyopneumoniae, and a method for quantitative detection using them. More specifically, it is a real-time fluorescent quantitative PCR primer and probe designed for the p110 gene of Mycoplasma pneumoniae, and a quantitative detection method using the same. Background technique [0002] Mycoplasma hyopneumoniae (Mhp) is the main pathogen causing swine enzootic pneumonia (SwineEnzootic Pneumoniae, EP). Porcine enzootic pneumonia is also known as swine asthma. It has the characteristics of high morbidity and low mortality. After the onset, chronic dry cough, slow growth, and stunted growth can occur. Pathogens such as Actinobacillus pleuropneumoniae, porcine reproductive and respiratory syndrome virus, Pasteurella pneumoniae a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/06C12N15/11
Inventor 侯绍华同弋
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap