Recombinant influenza virus vector carrying foreign genes in NA segment and preparation method and application thereof

An influenza virus and foreign gene technology, which is applied in the field of recombinant influenza virus as a viral vector and its preparation, can solve the problems of instability, high cost, and the inability of passage of recombinant influenza virus to achieve the effect of increasing the length

Inactive Publication Date: 2009-09-16
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In order to carry exogenous genes, there have been attempts to carry exogenous genes by introducing influenza subgenome fragments, but the genes carried are small and unstable (seeing the following documents: Vieira Machado, A., Naffakh, N., Gerbaud, S. , van der Werf, S., and Escriou, N. (2006). Recombinant influenza A viruses harboring optimized dicistronic NA segment with an extended native 5′terminal sequence: Induction of heterospecific B and T cell responses in mice. Virology 345(1), 73-87; the Chinese name of the literature is that the recombinant influenza A virus with an extended 5' end region can carry optimized Shuangshun rice in the NA segment, and induces heterospecific B and T cell responses in mice)
There are also attempts to use vesicular stomatitis virus virus surface glycoprotein (VSV-G) to replace the HA and NA proteins of influenza virus in order to obtain a recombinant influenza virus that NA can carry foreign genes, but the recombinant influenza virus cannot be passed on chicken embryos , the cost of cultivating and amplifying this influenza virus on special types of cells is relatively high (see the following literature: Shinya, K., Fujii, Y., Ito, H., Ito, T., and Kawaoka, Y. (2004 ).Characterization of aneuraminidase-deficient influenza A virus as a potential gene delivery vector and alive vaccine.Journal of Virology 78(6), 3083-3088; research on gene delivery vectors and live vaccines)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant influenza virus vector carrying foreign genes in NA segment and preparation method and application thereof
  • Recombinant influenza virus vector carrying foreign genes in NA segment and preparation method and application thereof
  • Recombinant influenza virus vector carrying foreign genes in NA segment and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Schematic diagram of the structure of an embedded NA fragment containing a foreign gene and a schematic diagram of the structure of a CMV / PolI bidirectional expression system.

[0041] figure 1 A, the composition of the whole recombinant NA segment from 3' to 5' is: the packaging signal of the NA gene segment (the 3' non-coding region of PR8NA and the first 183 nt of the coding region), the foreign protein expression frame (here preferably EGFP Reporter gene), 2A short peptide coding region, NA gene coding frame (ATG to stop codon, which includes 157nt packaging signal of coding region) and 5' non-coding region.

[0042] Schematic diagram of the structure of the bidirectional promoter CMV / Pol I ( figure 1 B), the specific structure is similar to that mentioned in the literature (Hoffmann, E., Neumann, G., Kawaoka, Y., Hobom, G., and Webster, R.G. (2000). A DNA transfection system for generation of influenza A virus from eight plasmamids.Proc Natl Acad Sci...

Embodiment 2

[0044] Example 2: Obtaining of DNA fragments fused with exogenous gene and 2A.

[0045] Synthesize two complementary oligonucleotide chains up and down, and form a double-stranded DNA fragment containing restriction site after annealing: GAATTC(EcoRI)agg ACCGGT(AgeI) tctggcgccaccaacttctccctgctgaa gcaggctggcgatgtggaggagaaccctGGGCCC (ApaI)atgACTAGT(SpeI) underlined part is 2A sequence. The double-stranded fragment was ligated and inserted into the pMD18T-simple vector (TaKaRa Company, Dalian), to obtain pT-2A ( figure 2 ), wherein EcoRI and AgeI sites were introduced at the 5' end, and ApaI and SpeI sites were introduced at the 3' end.

[0046] Using pCDNA-EGFP as a template, the EGFP reporter gene was amplified by PCR, the primers were GFP(1+20)EI and GFP(720-24)Age and the EcoRI site introduced at the 5' end and the AgeI site introduced at the 3' end , inserted into pT-2A to obtain pT-EGFP-2A ( figure 2 ). The EGFP+2A fusion fragment was excised by EcoRI and SpeI for ...

Embodiment 3

[0049] Example 3: Construction of pM-PR8NA(183)EGFP+2A+NA plasmid.

[0050]Using the plasmid pPolI-PR8NA containing the full-length PR8NA gene fragment as a template, using Sap-NA(1+20)EcoRV and PR8NA(183-24)EiAS as a primer pair, PCR technology was used to amplify the 3' end of the NA fragment of influenza virus Selectively package the signal part, including the 3' non-coding region and the first 183 nucleotides of the 3' coding region, and introduce EcoRV and SapI sites at one end of the non-coding region, and introduce EcoRI sites and AgeI at the 183 end site and SpeI site. Insert the pMD18T-simple vector to obtain pT-183 ( image 3 ).

[0051] pT-183 was digested with EcoRI and SpeI, and inserted into the EGFP+2A fusion fragment obtained in Example 2 to obtain pT-183EGFP+2A ( image 3 ).

[0052] Using the above-mentioned plasmid pPolI-PR8NA as a template, using PR8NA(1+26)ApaI and Sap-NA-1413R-XbaI as a primer pair, the first codon ATG to 5 of the influenza virus NA g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant influenza virus vector carrying foreign genes in an NA segment, which can be rescued in cells by a virus rescue method and can be amplified in chick embryos in large quantities. The invention also discloses a preparation method thereof, comprising the following steps: firstly constructing plasmids used for rescuing influenza viruses and introduced with the foreign genes on the NA genome segment of the influenza virus and carrying out rescue on host cells. The foreign gene is connected with the NA genome segment by a 2A segment. The foreign gene comprises EGFP reporter genes and adopts a CMV / huPolI bidirectional influenza virus rescue system. The recombinant influenza virus vector overcomes capacity limit of the foreign genes in the influenza virus genome, enjoys stable passage in chick embryos, can be applied to vaccine and drug development and tumor treatment and can produce recombinant cell factor drugs in cheap chick embryo bioreactors.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant influenza virus carrying a foreign gene as a virus vector and its preparation method and application. Background technique [0002] Viral vectors have been widely used in gene therapy research and vaccine development, and as effective gene delivery methods, they provide a powerful tool for basic research on life processes. The currently developed viral vectors are mainly DNA viruses, including adenovirus (Adenovirus, AdV), poxvirus (vacciniavirus), herpes virus (Herpes simple virus, HSV) and adeno-associated virus (Adeno-associated virus) vectors. , AAV). Although the lentiviral vector is an RNA viral vector, the functioning form of the lentiviral vector is the DNA form integrated into the host cell, and can also be classified as a DNA viral vector. There is a risk of integration of exogenous genes in the form of DNA in DNA virus vectors into the host genome, thus aff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/86A61K39/145A61P31/16A61K48/00A61P35/00C12P21/02C12Q1/70
Inventor李锋冯立强陈凌
OwnerGUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI