Rape mitogen-activated protein kinase gene and coding protein thereof

A technology for activating protein kinase and encoding protein, which is applied in the field of mitogen-activated protein kinase gene of rapeseed, can solve the problem that the specific function of rapeseed is not clear, and achieve the effect of obvious guiding effect

Inactive Publication Date: 2010-07-07
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, studies have found that the MAPK signaling chain plays an important role in the antifungal, antiviral and other plant defense responses mediated by the jasmonic acid signaling p

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rape mitogen-activated protein kinase gene and coding protein thereof
  • Rape mitogen-activated protein kinase gene and coding protein thereof
  • Rape mitogen-activated protein kinase gene and coding protein thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] A cDNA sequence of rape (Brassica oleracea) mitogen-activated protein kinase gene (MPK4), which has the base sequence in the sequence table SEQ ID NO: 1; sequence characteristics: 1332bp, linear double strand, originally derived from Brassica napus Hu Oil 15 (Brassica napus H); the amino acid sequence of a Brassica napus (Brassica napus) mitogen-activated protein kinase gene (MPK4): it has the amino acid sequence of SEQ ID NO: 2 in the sequence table, linear, single-chain, and 373 amino acids.

Embodiment 2

[0024] Example 2 Gene Chip Differential Display Obtaining cDNA Fragment Sequence

[0025] Material

[0026] Rapeseed variety Huyou 15 was cultivated in the greenhouse until the seedlings had 4-5 leaves, sprayed 50 mg / L chitosan oligosaccharide on the leaves, and sprayed double distilled water on the leaves as a control, and collected materials within 1 hour.

[0027] Total RNA extraction, quantification and integrity testing

[0028] The dust on the leaf surface was washed with double distilled water, ground in liquid nitrogen, and RNA was extracted with TRIZOL (Gibco BRL) reagent. (1) Quantification: measure the absorbance at 260 and 280nm, and calculate A 260 / A 280 values ​​to estimate the purity of total RNA. Pass A 260 Calculate the amount of total RNA from the value. (2) RNA integrity detection: separate total RNA on 1% formaldehyde denatured agarose gel, there are two clear bands, and the brightness of large molecular weight (28SrRNA) is approximately twice that o...

Embodiment 3

[0033] Example 3: Cloning of the 3' end

[0034] Use Takara's RNA PCR KIT (AMV) Ver.3.0 kit, use the primer TTGTATCAATTGTTGCGTGGA designed based on the cDNA fragment obtained above and the kit's own primer M13Primer M4, and use Takara's LA Taq enzyme to perform PCR (denaturation at 95°C for 5 minutes ; 92°C for 30 seconds, 52°C for 30 seconds, 72°C for 2 minutes as a reaction cycle, repeated 30 times; 72°C for 10 minutes;) The 3' end of this fragment was obtained. After agarose gel detection, the gel was recovered, and the recovered product was connected to the PMD 18-T carrier (Takara). The ligation product was transformed into E. coli Top10, screened by blue and white spots, and 10 white spot liquids were picked to expand culture and extract plasmids, denatured by PCR (95°C for 5 minutes; 92°C for 30 seconds, 52°C for 30 seconds, and 72°C for 2 minutes as one Reaction cycle, repeated 30 times; 72°C extension for 10 minutes;) After identification, sequenced by Shanghai Sango...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a rape mitogen-activated protein kinase gene (Mitogen Activated Protein Kinase, MAPK), in particular to a ubiquitous protein in ubiquitous (rape), the ubiquitous protein is an important element in an eucaryon signal transmission network; the protein is closely related to the plant diseases and insect pests resistance of the rape, the nucleotide sequence and amino acid sequence thereof are shown in a sequence table SEQ ID NO:1 and SEQ ID NO:2. The rape mitogen-activated protein kinase gene has the advantages that: the rape mitogen-activated protein kinase gene has obvious guiding function to the application of biopesticide; the gene clone is valuable to a molecule signal channel which discloses chitosan oligosaccharide induction plant defense responses and has important theoretical direction significance to the application of the oligosaccharide biopesticide.

Description

technical field [0001] The invention relates to a rapeseed mitogen-activated protein kinase gene, in particular to a rapeseed mitogen-activated protein kinase gene derived from Brassica napus H. Background technique [0002] Rapeseed mitogen-activated protein kinase (Mitogen Activated Protein Kinase, MAPK) is a kind of protein ubiquitous in eukaryotes (rape), and it is one of the important elements in the eukaryotic signal transmission network. In recent years, studies have found that the MAPK signaling chain plays an important role in the antifungal, antiviral and other plant defense reactions mediated by the jasmonic acid signaling pathway and the salicylic acid signaling pathway, but the specific function in rapeseed It is not well understood, especially the role in oligochitosan induction has not been reported. Contents of the invention [0003] The invention provides a rapeseed mitogen-activated protein kinase gene and its encoded protein, and discloses the relations...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/54C12N15/10C12N9/12
Inventor 杜昱光尹恒白雪芳赵小明李曙光
Owner DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap