Recombinant human arginase fusion protein and application thereof

A technology of fusion protein and arginase, applied in the field of genetic engineering

Inactive Publication Date: 2010-07-21
JIANGSU SIMCERE PHARMACEUTICAL R & D CO LTD
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] At present, there is no method to rapidly and high-concentrate exogenous arginase around tumor cells to simulate the release of endogenous arginase, and at the same time have high stability and circulation time to achieve effective treatment of tumors. fusion protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human arginase fusion protein and application thereof
  • Recombinant human arginase fusion protein and application thereof
  • Recombinant human arginase fusion protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1A

[0163] Embodiment 1A: Construction of NGR-arginase fusion protein recombinant strain

[0164](a) Isolation of the gene encoding human arginase Ⅰ

[0165] Primers were designed based on the published cDNA sequence of human arginase I (NM_000045). Polymerase chain reaction (PCR) was performed using Platinum I of TIANGEN to isolate the gene encoding human arginase I.

[0166] Primer ARG1: (5'-cg ggatcc cgccaagtccagaaccatag-3', SEQ ID NO: 4);

[0167] ARG2: (5'-ccc aagctt ttacttaggtgggttaaggtag-3', SEQ ID NO: 5) was purchased from SANGON. ARG1 contains a BamHI restriction enzyme recognition site (underlined), and primer ARG2 contains a HindIII restriction enzyme recognition site (underlined). These two primers (each at a final concentration of 400 nM) were added to 1 μl of a human liver cDNA library (Clontech) in a 0.2 ml cuvette. In addition, DNA Platinum Ⅰ (1 μl, 5 units), 4 kinds of deoxyribonucleic acids (each with a final concentration of 0.1 mM), reaction buffer (2.5...

Embodiment 1B

[0174] Example 1B: Construction of FCFWKTCT-arginase fusion protein recombinant strain

[0175] Design of primers containing the gene encoding FCFWKTCT

[0176] PRIMER2-SENSE (5' TATG TTCTGTTTCTGGAAGACGTGTACGG3', SEQ ID NO: 8);

[0177] PRIMER2-ANTISENSE (5' GATCC CGTACACGTCTTCCAGAAACAGAACA3', SEQ ID NO: 9) was purchased from SANGON, containing NdeI and BamHI sticky ends, these two primers (total 2μl, each with a final concentration of 50ng) were added to a 0.2ml small test tube, and PCR reaction buffer was added (2μl) and deionized water (16μl), a total of 20μl reaction system. Pairing was performed under the following conditions: 5 cycles (94°C, 1 min; 55°C, 1 min; 72°C, 1 min). The vector Pet-25b was treated with restriction enzymes BamHI and HindIII at 37°C for 2 hours. After completion, the reaction was subjected to agarose gel electrophoresis (1%), and a 6.5 kb DNA fragment was recovered from the gel using a common gel recovery kit (TIANGEN). The DNA product obta...

Embodiment 1C

[0178] Example 1C: Construction of DCLNGGTAVSNKYFSNIHWCN-arginase fusion protein recombinant strain

[0179] Design primers containing the gene encoding the urokinase fragment

[0180] PRIMER3-SENSE (5'GGAATTC CATATG GATTGTCTAAATGGAGGCACGGCAGTATCAAAACAAGTACTTCTCCAACAT3', SEQ ID NO: 10);

[0181] PRIMER3-ANTISENSE

[0182] (5′GAA GATCT GCTTCCAGAGCCACTCCCGTTACACCAGTGGATGTTGGAGAAGTACTTGTT3', SEQ ID NO: 11)

[0183] Purchased from SANGON, containing NdeI and BglII cohesive ends, these two primers (each with a final concentration of 50ng) were added to a 0.2ml small test tube, and DNA Platinum I (1 μl, 5 units), 4 kinds of deoxyribonucleic acid ( final concentration of 0.1 mM each) and reaction buffer (2.5 μl) and deionized water (17.5 μl). PCR was performed using the following conditions: pre-PCR (94°C, 5 minutes), 10 PCR cycles (94°C, 0.5 minutes; 58°C, 0.5 minutes; 72°C, 10 seconds), post-PCR (72°C, 7 minutes). The PCR product was treated with restriction enzymes BglII a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Conductanceaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of gene engineering, which relates to a recombinant human arginase fusion protein and application thereof. The recombinant human arginase fusion protein is a recombinant human arginase fusing any one polypeptide with an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. The fusion protein can effectively achieve the enrichment of drug in the tumor site and prevent homeostatic mechanism of amino acid to a certain degree so as to obtain good therapeutic effect.

Description

field of invention [0001] The invention belongs to the field of genetic engineering and relates to a recombinant human arginase fusion protein and its application. Background technique [0002] Arginine plays a very important role in the growth and metabolism of the body. It is the only amino acid source for creatine synthesis, and it is also the precursor of polyamine synthesis, which plays a very important role in cell division and tissue growth and differentiation. In addition, arginine is also involved in important physiological events such as protein synthesis and regulation of nitric oxide signaling. The metabolism of arginine in the body is best known by the liver. Arginase in the liver (see Masaki Takiguchi, Human liver-type arginase gene: structure of the gene and analysis of the promoter region. Nucleic Acids Research: Volume 16 Number 18, 1988.) can effectively Hydrolyze arginine to ornithine and urine. Ornithine is transported by the liver to the blood circul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K17/08A61K38/50A61P1/16A61P35/00
Inventor于鹏展周兵覃丹秦国宏周小林祝晓梅
OwnerJIANGSU SIMCERE PHARMACEUTICAL R & D CO LTD