Small RNA (Ribonucleic Acid) quantitative detecting method and reagent kit

A quantitative detection method and quantitative detection technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of low detection sensitivity, high false positive rate, and the inability to detect short fragments of small RNA, etc. Achieve the effect of high detection sensitivity, good specificity and cheap kit

Active Publication Date: 2010-09-15
广州锐博生物技术有限公司
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The direct quantitative PCR method can be used to detect the precursors of small RNAs, but cannot be used to detect short fragments of small RNAs. Later, quantitative PCR was improved, and the method of artificially extending small RNAs was used to achieve the purpose of quantitative detection of small RNAs (chen.KF et al., 2005), but this method requires the use of Taqman probes
Microarray’ is a chip hybridization method based on northern detection of RNA, but the detection sensitivity of this method is low, the false positive rate is high, and radioactive probes may be used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small RNA (Ribonucleic Acid) quantitative detecting method and reagent kit
  • Small RNA (Ribonucleic Acid) quantitative detecting method and reagent kit
  • Small RNA (Ribonucleic Acid) quantitative detecting method and reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: Detection of miRNA expression in cells

[0047] Take the detection of hsa-let-7a, hsa-miR-10b expression in A549, HeLa, HEK293 cells as an example.

[0048] 1. Related primer design

[0049] 1), RT primers with Bulge loop structure:

[0050] hsa-let7a-RT1: (SEQ. NO: 1) GCACTTCAGTGTCGTGGTCAGTGACGGCAATTTGAAGTGCAACTATAC

[0051] hsa-miR10b-RT1: (SEQ. NO: 2) GCACTTCAGTGTCGTGGTCAGTGACGGCAATTTGAAGTGCCACAAATT

[0052] 2), PCR forward primer

[0053] hsa-let7a-F1: CAGACGACCATCAGTGAGGTAGTAGGTTGA (SEQ. NO: 3)

[0054] hsa-miR10b-F1: CAGACGACCATCAGTACCCTGTAGAACCGAA (SEQ.NO: 4)

[0055] 3), universal reverse primer

[0056] G-R1: GCACTTCAGTGTCGTGGTCAGTGACGGCAATT (SEQ. NO: 5)

[0057] 2. cDNA preparation

[0058] A549, Hela, and HEK293 cells were used as materials respectively, and the cells were lysed with Trizol from Invitrogen Company, and the total RNA of the cells was extracted by adding chloroform and isopropanol according to routine operations, and hsa-let7...

Embodiment 2

[0062] Detection of miRNA expressed in human secretions, blood, and semen

[0063] Human secretions include saliva, vaginal secretions, sweat, etc. Saliva, semen and other liquid samples were added to Trizol at a ratio of 1:3 to extract RNA, and vaginal secretions were transferred to EP tubes with cotton swabs and added to Trizol for RNA extraction. Blood samples were collected in EDTA anticoagulant tubes, and a part was taken as a whole blood sample. The anticoagulated blood was centrifuged at 4000 rpm for 10 minutes at 4 degrees, and the upper layer was plasma. Plasma samples were added to Trizol at a ratio of 1:3 to extract RNA. The primer sequence is shown in Example 1, and the miRNA detection result is as follows Figure 5 , the test results show that this method can be used for the detection of small RNA in human secretions.

Embodiment 3

[0065] Detection of miRNA expressed in blood

[0066] Taking the detection of miR-150 in human blood samples as an example, U6 was used as an internal reference, and leukocytes were collected by centrifugation after blood collection. The RNA extraction of leukocytes and the detection process of miRNA were the same as in Example 1. The sequences of related primers for miR-150 and U6 were as follows:

[0067] name

[0068] The test results show that this method can detect the expression of miRNA from blood cells ( Figure 6 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a small RNA quantitative detecting method and a reagent kit, which are used for expression analysis of a small RNA, and the method comprises the following steps of: reversely transcribing the small RNA into a cDNA (complementary Deoxyribonucleic Acid) through a bulge loop RT (Reverse Transcription) primer, and adding a PCR (Polymerase Chain Reaction) forward primer and a PCR universal reverse primer for quantitative PCR amplification. The small RNA quantitative detecting method and the reagent kit have the advantages of high sensitivity, good specificity, low price of the reagent kit and the like and can be used for batch detection.

Description

technical field [0001] The invention relates to a quantitative detection method and kit for small RNA. Background technique [0002] Small RNAs in organisms include microRNA (microRNA, miRNA), small interference RNA (small interfering RNA, siRNA), piwi protein related RNA (piwi protein-related RNA, piRNA), small nuclear RNA (nuclear small RNA, snRNA), small Nucleolar RNA (nucleolar small RNA, snoRNA), etc. These small RNAs play a variety of functions in organisms. miRNA and siRNA mainly negatively regulate the expression of coding genes, piRNA mainly positively regulate gene expression, and snRNA participates in the processing and maturation of proteins , snoRNA is involved in the splicing of rRNA. With the deepening of research, new functions and mechanisms of various small RNAs are being continuously revealed. [0003] miRNA is one of the most popular small RNAs at present. It is a kind of small RNA with a length of about 22bp. It is matured by dicer enzyme from the precu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor张必良冯世鹏
Owner广州锐博生物技术有限公司