Nucleotide sequence fragments that promote high-efficiency expression of foreign proteins in cho cells

A nucleotide sequence and high-efficiency expression technology, applied in the field of nucleotide sequences derived from CHO cells, can solve problems such as insufficient expression, poor predictability of protein production, and unstable long-term expression

Inactive Publication Date: 2012-02-15
JINAN UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still some shortcomings in the production of this platform, including poor predictability of protein production, unstable and insufficient expression of long-term expression, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleotide sequence fragments that promote high-efficiency expression of foreign proteins in cho cells
  • Nucleotide sequence fragments that promote high-efficiency expression of foreign proteins in cho cells
  • Nucleotide sequence fragments that promote high-efficiency expression of foreign proteins in cho cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Obtaining and Sequence Identification of KH Sequence

[0033] Take about 1×10 cultured CHO cells 7 One, using the genome extraction kit to obtain the CHO genome, and then design the specific upstream primer KHF: 5'>TGCTTTGAATGTTCAAGTAGGATCTAATGTACATCATGAG<3';

[0034] The PCR reaction system is: CHO genomic DNA 2ul, dNTP2ul, KHF2ul, KHR2ul, LA-taq 0.5ul, 10×LA-taq Buffer 2ul, H 2 O 9.5ul, total volume 20ul;

[0035] The PCR reaction program was as follows: 10 min at 94°C, 30 sec at 94°C, 30 sec at 60°C, 45 sec at 72°C, a total of 32 cycles, and finally 10 min at 72°C. For the results of the PCR reaction, see figure 1 .

[0036] The obtained PCR product was directly loaded into the pMD 19-T vector for sequencing identification. The sequencing result is shown in SEQ ID NO.1.

Embodiment 2

[0037] Embodiment 2: Apply KH sequence to make luciferase in CHO / dhfr - highly expressed in cells

[0038] Take the pIRESneo3 plasmid, insert the nucleotide sequence into the upstream, downstream and upstream of the exogenous gene transcript, and construct two different vectors, named pIN-KH and pIN-2KH respectively; then insert luciferase into The multiple cloning sites were constructed as recombinant expression vectors named pIN-KH-Luc and pIN-2KH-Luc respectively, such as figure 2 . In addition, the control plasmid pIN-Luc was constructed again.

[0039] Using liposome transfection method, pIRESneo3, pIN-Luc, pIN-KH-Luc and pIN-2KH-Luc were transfected into CHO / dhfr-cells respectively, and an internal reference plasmid pRL-TK was transfected at a ratio of 1 / 10 The transfection was carried out on a 24-well cell culture plate, using different amounts of liposomes and DNA. For the operation method, refer to the instruction manual of Lipofectamine2000 liposome reagent provi...

Embodiment 3

[0048] Example 3: Using KH sequence to make FGF2 highly expressed in CHO / DG44

[0049] 2.1 Construction, identification and large-scale preparation of recombinant expression vectors

[0050] Using the nucleotide sequence of Fibroblast Growth Factor 2 (FGF2) as a template, FGF2 was amplified by PCR, double digested with Nhe I and HindIII, and the eukaryotic expression vectors pcDNA3.1 and pcDNA3.1-KH were taken, Digested with Nhe I and HindIII, connected with T4 ligase and transformed into competent Escherichia coli DH5α, spread on LB-AMP+ plate, 16-18 hours at 37°C, screened and picked 3-5 single colonies, in 5ml The LB-AMP+ medium was expanded, the plasmid was extracted, the recombinant was identified by two methods of enzyme digestion and PCR amplification of the target sequence, and the correct recombinant expression vector was obtained by sequencing and identification, which were named pcDNA3.1-FGF2 and pcDNA3 respectively. 1-KH-FGF2. The recombinant strain was amplified...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The nucleotide sequence fragment that promotes high-efficiency expression of foreign protein in CHO cells, its nucleotide sequence is shown in SEQ ID NO.1. In the present invention, the KH sequence is cloned to both sides or one side of the transcripts of different expression vectors, and then the corresponding foreign genes are cloned, and the expression vectors expressing different foreign genes are used to transfect CHO-K1 and CHO / dhfr respectively. -, DG44 and other cells, after checking the corresponding monoclonal cell formation rate, monoclonal cell passage stability, exogenous gene expression level, etc., the data show that the vector with KH sequence can increase the expression level of exogenous gene and increase the expression level of exogenous gene. Genetic stability.

Description

technical field [0001] The invention belongs to the application field of bioengineering technology, and mainly relates to a nucleotide sequence derived from CHO cells. Background technique [0002] According to the type of host cell, gene expression systems can be roughly divided into prokaryotic, yeast, plant, insect and mammalian cell expression systems. Compared with other systems, the advantage of the mammalian cell expression system is that it can guide the correct folding of the protein, and provide various post-translational processing functions such as complex N-type glycosylation and accurate O-type glycosylation. Molecular structure, physical and chemical properties and biological functions are closest to natural higher biological protein molecules. [0003] Over the past decade, remarkable progress has been made in the study of high-efficiency expression of recombinant proteins using mammalian cell expression systems. At present, the mammalian cell expression sy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/63C12N1/00
Inventor陈小佳洪岸
OwnerJINAN UNIVERSITY