Unlock instant, AI-driven research and patent intelligence for your innovation.
Turbot reovirus whole genome and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of reovirus and turbot, applied in the field of aquatic animal virus, to achieve the effect of standardized operation and rapid diagnosis
Inactive Publication Date: 2012-04-04
INST OF AQUATIC LIFE ACAD SINICA
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
Turbot reovirus (Scophthalmus maximus reovirus, SMReV) is the first reovirus pathogen isolated and identified from diseased turbot by us. aquareovirus), mainly infects the important economic fish turbot, the genome sequence information and functional genes of this virus have not been reported yet
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0045] A method for preparing the whole gene of turbot reovirus, the steps of which are:
[0046] A, extraction of turbot reovirus nucleic acid:
[0047] Use TrizolReagentreagent (Invitrogen) to extract turbot reovirus dsRNA nucleic acid, see the reagent manual for details. Add 100 μl of virus suspension to 900 μl of Trizolreagent, invert and mix 5-10 times, and let stand at 15-30°C for 5 minutes to completely lyse the virus protein. Add 0.2ml of chloroform, shake the Eppdorf tube vigorously for 15s, let stand at 15-30°C for 2-3min; centrifuge at no more than 12,000g for 15min at 2-8°C; Mix well with isopropanol, let stand at 15-30°C for 10min; centrifuge at no more than 12,000g for 10min at 2-8°C; Centrifuge at no more than 7,500 g for 5 min; discard ethanol, dry in air for 10 min; add 20 μl of DEPC-treated water, and store at -80 °C for later use.
[0063] Example 2: The turbot reovirus gene sequence and its encoded protein are used in the preparation of turbot reovirus diagnostic reagents.
[0064] The following uses the protein encoded by the S11 segment as an example to illustrate the application of the turbot reovirus genome sequence in virus detection drugs:
[0066] The nucleotide sequence of the gene encoding the S11 segment was designed and constructed into a prokaryotic expressionplasmid in the pET32a vector: use primers P5 / P6 (P5: 5'GAAGAATTCGGAGCAGGAATG 3'; P6: 5'GCCAAGCTTACTCAAGACTCTACTC 3') to amplify, and the amplified product and The pET32a vector was double-digested at the same time, using endonucleases EcoR I and Hind III. The digested products were ligated with T4 DNA ligase, transformed into E.coli DE3, and positive clones were selected.
[0067] The positive clones were cultured to the logarithmic phase, and induced by adding IPTG with a final concentr...
[0079] A. The nucleotide sequence of S7 segment 1-613 bases is designed and constructed into a eukaryotic expression plasmid in the pcDNA3.1 vector:
[0080] Use primers P3 / P4 (P3: 5'ACTGGTACCGTTTTAGTCAATCATCCTG 3'; P4: 5'ATTCTCGAGTAAAGTC AACGGAAG 3') for PCR amplification;
[0081] B. Simultaneous double digestion of the amplified product and the pcDNA3.1 vector, using endonucleases Kpn I and Xho I. The digested product was ligated with T4DNA ligase, then transformed into Escherichia coli DH5α, and positive clones were selected;
[0082] C. The successfully constructed clones were cultured at 37 degrees for 12 hours in a medium containing ampicillin, and the plasmid was extracted using an endotoxin-free plasmid extraction kit (OMEGA), according to the operation manual;
[0083] D. The successfully constructed plasmid was transfected into a fish cell line using Lipofectamine2000 transfection reagent (Invitrog...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a turbot reovirus whole genome as well as a preparation method and application thereof. The method comprises the following steps of: A. extraction of turbot reovirus nucleic acid: extracting turbot reovirus dsRNA (double-stranded Ribonucleic Acid) by using a TrizolReagent; B. artificial joint connection: carrying out agarosegel electrophoresis on purified virusnucleic acid and recycling all sections of dsRNA by using a gel recovery kit; C. reverse transcription: carrying out reverse transcription on the dsRNA connected with an artificial joint by using a primer; D. PCR (PolymeraseChain Reaction) amplification and sequence detection: carrying out PCR amplification on 2 microliters of cDNA, cutting off an amplified belt, connecting the amplified belt to a carrierafter recycled and selecting a positive clone for sequence detection; and E. expression of an NS22 gene in a fish culture cell and confirmation of an initiation codon: designing and constructing a nucleotide sequence of a 1-613 basic group in the S7 section in a carrier into an eukaryotic expression plasmid. The invention also provides application of a turbot reovirus gene sequence and the coded protein thereof in preparing a turbot reovirus diagnostic reagent or being used as a cell fusion inductive agent.
Description
technical field [0001] The present invention relates to aquatic animal viruses, in particular to a turbot reovirus genome, and to the application of a turbot reovirus genome in virus detection, in particular to a turbot reovirus genome derived from turbot reovirus S7 Functional use of an inducible cellfusion protein by segmental cloning. Background technique [0002] Reoviruses are viruses with segmented double-stranded RNA genomes that broadly infect humans, other vertebrates, insects and plants. The early diagnosis of viral diseases and vaccine immunization play a key role in the prevention of viral diseases, and the nucleic acid sequence of the viral genome can be used as a specific molecular marker for detecting viruses in vivo and in vitro, and is also the target of antiviral drugs and the basis for the development of viral vaccines. material. Therefore, the isolation and identification of aquatic reovirus and its genome are the prerequisites for molecular diagnosis ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More