Streptococcus iniae vaccine and preparation and application thereof

A technology for Streptococcus iniae and vaccine preparation, applied in the field of molecular immunology, can solve problems such as poor vaccine protection effect and no commercial vaccine, and achieve high protection effect and simple preparation effect

Inactive Publication Date: 2010-10-27
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In countries such as Israel and Spain, inactivated vaccines against Streptococcus dolphin have been widely used in aquaculture, but in recent years it has been found that the protective effect of these vaccines is not good
In my country and other Asian countries, the prevention and control of Streptococcus iniae mainly relies on antibiotics, and there is no commercial vaccine yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] The Streptococcus iniae vaccine is shown by the base sequence in the sequence listing SEQ ID No.1 (see sequence listing 1).

[0021] Sequence Listing 1

[0022] ATGCGTAACAAATTCTTTTCTTTACTCGTCGCTTCAACAACAGTTCTTAGTTTGGCGGCATGTGGATCAAAACAAGAAGC

[0023] TAAAAAAGAGGATAAGGGCAGTGATAAACTGGTTGTTTACTCCTCCCAATTCAGAAGGCTTAATCAATGCGACAATTCCAG

[0024] CTTTTGAGGAAAAATATGGGGTTAAGGTTGAATTGATCCAAGCAGGTACTGGGGAACTCTTTTAAAAAAGTTGAGAGTGAA

[0025] GCAAGTAAACCAGTTGCTGATATTGTCTTTGGAGGTTCTTATACTCAGTATGCTCAACATCCTAGTTTATTTGAAAAATA

[0026] CACTGCAAAAGATAATGACAAGGTGATTAAGGATTATCAAAATACAACTGGCTATTCAACACCATACACCTTAGATGGTT

[0027] CTGTTTTGATTGTTAATCCTGATTTGACAAAAGGCATGAAGATTAAAGGTTACAAAAGATTTATTGAACCCTGAGTTGAAA

[0028] GGCAAGATTGCAACAGCAGACCCTGCTAACTCAATCAAGTGCTTTTGCACAATTAACTAATATTTTACTTGCTAATGGTGG

[0029] TTACGATAAAGACCAATCATGGTCTTATGTCAAAGACTTATTTACCTTGGTAGATGGTAAAATTAATTCAAGTTTCCAA

[0030] ATGTTTACAAAATCTGTAGCTGATGGTGAAATGGCTGTTGGTTTGTCCTATGAAGACCCAAGTGTTAAATTATTAAATGAT

[0031] GG...

Embodiment 2

[0046] The construction method of Streptococcus iniae vaccine:

[0047] 1) Construction of strain DH5α / pTASP11: Streptococcus iniae G26 was used as template and F2 / R5 was used as primer for PCR amplification. After 5 cycles, change to 94°C for 40s, 56°C for 60s, and 72°C for 60s. After 25 cycles, extend the reaction at 72°C for 10 minutes. After the PCR product was purified with Tiangen DNA Product Purification Kit, it was ligated with the PCR cloning vector pBS-T (purchased from "Tiangen Biochemical Technology Co., Ltd.", Beijing) at room temperature for 2-4 hours, and the ligation mixture was transformed into Escherichia coli DH5α In the presence of 100ug / ml anka penicillin (Ap), 40ug / ml Xgal (5-bromo-4-chloro-3-indole-β-D-lactoside) and 24ug / ml isopropyl-β-D-sulfur The galactoside (IPTG) LB solid medium was cultured for 18 hours, the white transformant was screened out, and the plasmid was extracted, which was the plasmid pBSSP11. Plasmid pBSSP11 was digested with NdeI / Xh...

Embodiment 3

[0051] Application of Streptococcus iniae Vaccine

[0052] Step 1) Preparation of vaccine preparation solution and vaccine control solution. The above-mentioned bacterial strain DH5α / pTASP11 expressing the protein encoded by the nucleotide sequence in the sequence table SEQ ID No.1 was cultured overnight in LB liquid medium containing 50ug / ml Ap; take 0.1ml overnight culture solution , add it to 10ml of fresh LB liquid medium containing Ap (50ug / ml), shake at 160rpm at 37°C until OD 600 0.8-1, then the culture solution was centrifuged (5000g, 4°C, 10min), the bacteria were collected, and suspended in PBS to a final concentration of 4x10 8 cfu / ml is the vaccine preparation solution.

[0053] The PBS composition is by weight percentage: 0.8% NaCl, 0.02% KCl, 0.358% Na 2 HPO 4 .12H 2 O, 0.024% NaH 2 PO 4 .

[0054] Step 2) Immunization injection of the vaccine. 80 flounder (each weighing about 10 g) were randomly divided into 2 groups, 40 in each group. These two groups...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of the molecular immunology, in particular to a streptococcus iniae vaccine and preparation and application thereof. Particularly, the vaccine is expressed by a base sequence in a sequence table SEQ ID No.1. A preparation method comprises the following steps: using streptococcus iniae G26 as a template and using a primer F2 / R5 to carry out PCR; and connecting a PCR product with plasmids pBTA1 and converting colon bacillus DH5l alpha by the connecting solution to obtain a bacterial strain DH5 alpha / pTASP11, i.e. a bacterial strain of the streptococcus iniae vaccine, which expresses a protein encoded by the base sequence in the sequence table SEQ ID No.1. The application of the streptococcus iniae vaccine is that the obtained bacterial strain of the streptococcus iniae vaccine is cultured by an LB culture medium until OD600 is 0.8 and then is dissolved in PBS and the obtained vaccine preparation solution has effect on immune protection for the streptococcus iniae. The obtained vaccine of the invention has very simple preparation process and does not need any extraction and purification process. The protection efficiency of the streptococcus iniae vaccine aiming at streptococcus iniae infection reaches 100 percent.

Description

technical field [0001] The invention relates to the field of molecular immunology, in particular to a Streptococcus iniae vaccine and its preparation and application. Background technique [0002] Streptococcus iniae is a Gram-positive bacterium belonging to the genus Streptococcus in the family Streptococcus. The bacterium is a conditional human / fish / zoonotic pathogen, which can not only infect a variety of seawater and freshwater fish, such as red sea bream, tilapia, grouper, flounder, perch, rainbow trout, etc., but also infect In humans, it causes diseases such as cellulitis, meningitis, and endocarditis. Currently, Streptococcus iniae is recognized as one of several important fish pathogens worldwide. In countries such as Israel and Spain, inactivated vaccines against Streptococcus iniae have been widely used in aquaculture, but in recent years it has been found that the protective effect of these vaccines is not good. In my country and other Asian countries, the pre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/09A61P31/04C12N15/31
Inventor孙黎程爽
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI