Pegylation hypoglycemic polypeptide and preparation method and application thereof

A technology for PEGylation and hypoglycemic peptides, which is applied in the preparation methods of peptides, chemical instruments and methods, biochemical equipment and methods, etc. Improve medication compliance, high stability, and pain relief

Active Publication Date: 2010-12-08
CHINA PHARM UNIV
View PDF15 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These effects make GLP-1 an ideal drug candidate molecule for the treatment of diabetes, but the GLP-1 prototype molecule has not been used clinically for many years, mainly because GLP-1 has a very short action time in the body and its plasma half-life is less than 2 minutes. After intravenous administration, it is quickly inactivated by endogenous dipeptidyl peptidase (DPP4) cutting off 2 amino acids from the N-terminus, and the fragment GLP-1 (9-36) produced after enzymatic hydrolysis is the natural GLP-1 Antagonists, which further inhibited the effect of GLP-1
Second, the modified polypeptide has certain immunogenicity, and the polypeptide needs to be administered repeatedly for a long time in the treatment of diabetes, and the problem of immunogenicity becomes particularly serious
Third, there are many problems in the physical and chemical properties of the modified or allosteric polypeptide molecules obtained by structural modification (for example, the use of fatty acid modification will lead to a decrease in water solubility)
Fourth, the duration of the hypoglycemic effect of many modified polypeptides in vivo is still not long enough (for example, the in vivo half-life of exendin-4 that is already on the market is only about 2.4 hours)
However, the molecules finally obtained in previous studies either had the problem of increased stability but decreased activity, or had the problem of increased activity but decreased stability
So far, no ideal molecular structure with high agonist activity, low immunogenicity and long action time in vivo has been reported in literature or patent applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pegylation hypoglycemic polypeptide and preparation method and application thereof
  • Pegylation hypoglycemic polypeptide and preparation method and application thereof
  • Pegylation hypoglycemic polypeptide and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Recombinant expression and preparation of PEGylated hypoglycemic polypeptide

[0055] According to the amino acid sequence of the hypoglycemic polypeptide according to claim 1, its amino acid sequence is as follows:

[0056] His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp- Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Cys.

[0057] Corresponding DNA sequences were designed and synthesized according to the codon table of Escherichia coli and considering its codon preference. The final design and optimization of the resulting DNA sequence is as follows:

[0058] 5'-CACGGTGAAGGTACTTTTCACCTCTGACCTGTCTAAACAGATGGAAGAAGAAGCTGTTCGTCTGTTCATCGAATGGCTGAAAAACGGTGGTCCGTCTTCTGGTGCTCCACCGCCATCTTGC-3'.

[0059] Add the DNA sequence corresponding to the aspartic acid-aspartic acid-aspartic acid-aspartic acid-lysine sequence at the 5' end of the sequence, and add a TAA stop codon at its 3' end. This fragment was inserted i...

Embodiment 2

[0067] Solid Phase Synthesis of Pegylated Hypoglycemic Peptides

[0068] According to the amino acid sequence of the hypoglycemic polypeptide according to claim 1, its sequence is as follows:

[0069] His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp- Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Pro-Ser-Cys (CONH 2 ),

[0070] Among them, Cys(CONH 2 ) is carboxyl amidated cysteine. The Fmoc-protected amino acid is used for solid-phase synthesis reaction, and the whole reaction is completed on a peptide solid-phase synthesizer.

[0071] The synthesized polypeptide is purified by preparative reverse-phase liquid chromatography to obtain the target hypoglycemic polypeptide with a purity higher than 98%, and the physical molecular weight of the obtained polypeptide is detected by ESI-MS. The measurement results showed that the physical molecular weight of the obtained polypeptide was 4289.7Da. Tricine-SDS-PAGE test res...

Embodiment 3

[0097] Analysis of Physicochemical Properties of Pegylated Hypoglycemic Peptides

[0098] The amino acid sequence structure of the hypoglycemic polypeptide is as follows:

[0099] His-Gly-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Leu-Ser-Lys-Gln-Met-Glu-Glu-Glu-Ala-Val-Arg-Leu-Phe-Ile-Glu-Trp- Leu-Lys-Asn-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Por-Ser-Cys (CONH 2 ),

[0100] Among them, Cys(CONH 2 ) is carboxyl amidated cysteine. 5kDa, 10kDa, 20kDa, 30kDa, and 40kDa maleimide-activated polyethylene glycol were used to modify the polypeptide with polyethylene glycol, and the obtained pegylated hypoglycemic polypeptides were named: PEG5K-GP, PEG10K-GP, PEG20K-GP, PEG30K-GP, and PEG40K-GP.

[0101] The detection methods for their physical and chemical properties are the same, and only PEG20kDa modified glucose-lowering peptide (PEG20K-GP) is used as an example to illustrate below.

[0102] Purity analysis. The chromatographic purity and electrophoretic purity of the obtained PEGylated hypo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Apparent molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses pegylation hypoglycemic polypeptide. The pegylation hypoglycemic polypeptide has an amino acid sequence as shown by the sequence 1 (SQDID NO:1): His-Gly-Glu-Gly-Xaa1-Phe-Thr-Ser-Asp-Leu-Ser-Xaa2-Xaa3-Xaa4-Glu-Glu-Glu-Ala-Va1-Xaa5-Leu-Phe-I le-Glu-Trp-Leu-Xaa6-Xaa7-Gly-Gly-Pro-Ser-Ser-Gly-Ala-Pro-Pro-Pro-Ser-Xaa8; and a side-chain hydrosulfide group of C-terminal amino acidXaa8 of the hypoglycemic polypeptide is in covalent linkage with polyethylene glycol. The GLP-1 receptor stimulating agent activity of the pegylation hypoglycemic polypeptide is higher than that of aGLP-1 prototype molecule. A peptide sequence of the molecule does not contain recognition sites of dipeptidyl peptidase and neutral peptidase and has high stability. Besides, due to the masking action of the polyethylene glycol, the immunogenicity of a modified peptide molecule is basically eliminated, and when the polyethylene glycol of which the molecular weight is over 20 kDa is adopted to perform modification, the pharmacokinetic half-life of the pegylation hypoglycemic polypeptide can be over 48 hours.

Description

technical field [0001] The invention relates to a pegylated hypoglycemic polypeptide and its use as a drug for treating diabetes. Background technique [0002] Diabetes mellitus is a metabolic disease of multiple etiologies characterized by chronic hyperglycemia accompanied by disturbances in carbohydrate, fat and protein metabolism due to defects in insulin secretion and / or action. Diabetes can be easily divided into type 1 and type 2. Type 1 diabetes is insulin-dependent; type 2 diabetes is insulin-independent. Type 2 diabetes accounts for 90%-95% of the numerous diabetic patients. [0003] The incidence of diabetes is increasing year by year. According to WHO statistics, the current incidence of diabetes is 2.8%, and it is expected that this value will increase to 4.8% by 2030. According to the CDCP report of the United States, diabetic patients account for 6.8% of the entire American population, and 90-95% of them are type 2 diabetic patients. With the improvement o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/575C07K1/107C07K1/20C07K1/18C07K1/06C07K1/04C12N15/16C12N15/70A61K38/22A61K47/48A61P3/10A61K47/60
Inventor姚文兵高明明金宇灏高向东田浤
OwnerCHINA PHARM UNIV