Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method for expressing desmodus rotundus salivary plasminogen activator in pichia pastoris

A technology of plasminogen and Pichia pastoris, which is applied in the field of genetic engineering, can solve the problems such as unfavorable eukaryotic protein expression, low expression amount and high expression cost of Escherichia coli expression system

Inactive Publication Date: 2010-12-15
SOUTHWEST UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0019] In view of the defects of the existing technology: the expression in CHO cells, insect cells, and tobacco is expensive, and the expression level is also low, and the E. coli expression system is not conducive to the expression of eukaryotic cell proteins, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing desmodus rotundus salivary plasminogen activator in pichia pastoris
  • Method for expressing desmodus rotundus salivary plasminogen activator in pichia pastoris
  • Method for expressing desmodus rotundus salivary plasminogen activator in pichia pastoris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Artificial synthesis of DSPAα1 gene

[0033] DSPAα1 was obtained from Gene Bank, its own signal peptide sequence was removed, and for the convenience of cloning into the pPIC9K plasmid in the next step, an Xho I restriction site was designed at the 5′ end, and an EcoR I restriction restriction site was designed at the 3′ end The site, a total of about 1340bp, was artificially synthesized in full length by Shanghai Sangong in vitro, cloned into the pUC57 vector, and transformed into E. coli TOP10 for stable storage.

[0034] Gene fragments:

[0035] 5'CG CTCGAG AAAAGA coded GC

[0036] Xho I

[0037] ATATGGTGTG GCCTGCAGAG ACGAAAAAAC CCAGATGATA TACCAGCAAC AAGAGTCGTG GCTGCGCCCC

[0038] GAGGTCAGAA GCAAGCGGGT AGAACACTGC CGGTGCGATA GAGGATTGGC CCAGTGTCAC ACCGTGCCTG

[0039] TCAAAAGTTG CAGTGAACTG AGGTGCTTCA ATGGGGGGAC ATGCTGGCAG GCTGCATCTT TCTCAGACTT

[0040] TGTCTGTCAG TGCCCTAAAG GATATACGGG GAAACAGTGT GAAGTAGATA CCCATGCCAC CTGCTACAAG

[0041] GACCAGGGTG TCA...

Embodiment 2

[0058] Embodiment 2: the construction of carrier

[0059] (1) Amplification of the target gene DSPAα1

[0060] Use upstream primer: 5′-CCG CTCAGA AAAAGAGCATATGGTGTGGCCTGC-3'

[0061] Xho I

[0062] Downstream primer: 5′-GCGCGCG GAATTC TTATGGGCGCATGTTGTCTCG-3′

[0063] EcoR I

[0064] Using the plasmid pUC57 / DSPAα1 as a template, the target gene DSPAα1 was amplified by PCR

[0065] (2) Amplification of 5'His DSPAα1 gene

[0066] Up primer (5' end primer):

[0067] CCG CTCGAG AAAAGA GCATATGGTGTGGCCTGC

[0068] XhoI His Tag EK restriction site

[0069] Down primer (3' end primer): GCGCGCG GAATTC TTATGGGCGCATGTTGTCTCG

[0070] EcoR I

[0071] The 5'His DSPAα1 gene was amplified by PCR using the plasmid pUC57 / DSPAα1 as a template.

[0072] (3) Cloning the target gene DSPAα1, 5'His-DSPAα1 into the expression vector pPIC9K

[0073] 1) The target genes DSPAα1 and 5'His-DSPAα1 amplified by PCR were simultaneously digested with Xho I and EcoR I respectively, complet...

Embodiment 3

[0076] Example 3: Construction of DSPAα1, 5'His-DSPAα1 Pichia pastoris expression strain

[0077] (1) Linearization of DSPAα1 / pPIC9K, 5'His-DSPAα1 / pPIC9K

[0078] First, a large amount of DSPAα1 / pPIC9K and 5'His-DSPAα1 / pPIC9K were extracted from Escherichia coli TOP10 by alkaline lysis method, and then the above-mentioned plasmid DNA was digested with excess restriction endonuclease Sal I to make it completely linearized, and the agar After sugar gel electrophoresis, the digested products were recovered using a gel recovery kit (TIANGEN) and stored in a -20°C refrigerator for later use.

[0079] (2) Transformation of yeast cells

[0080] Take 100 μL of Pichia pastoris GS115 (purchased from Invitrogen, USA) stored in a refrigerator at -20°C, inoculate in 3mL LYPD medium and shake overnight at 30°C, take 2.5mL of the activated bacterial liquid and insert it into 250mL LYPD liquid medium and shake overnight at 30°C , to OD600=1.3-1.5, collect the cells to prepare competent cells;...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for expressing a desmodus rotundus salivary plasminogen activator in pichia pastoris is realized by the following steps: artificially synthesizing the full-length gene of the desmodus rotundus salivary plasminogen activator (Bat-PA) in vitro, then cloning the full-length gene on an expression vector pPIC9K and then transforming a linearized recombinant plasmid to a yeast cell by electroporation to be stably integrated on a yeast chromosome. The method stably and efficiently expresses the Bat-PA, especially DSPAalpha1 in pichia pastoris, thus lowering the production cost, improving the expression quantity and ensuring the generated recombinant protein to have the bioactivity of the natural protein. The purified protein can be used for treating various thrombotic cardio-cerebro vascular diseases.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for expressing and producing a vampire bat salivary plasminogen activator recombinant protein in Pichia pastoris. Background technique [0002] Thrombotic diseases, especially cardiovascular and cerebrovascular thrombotic diseases, are one of the diseases that seriously endanger human health. The current data provided by the World Health Organization (WHO) highlight that cardiovascular disease (CVD) is the cause of the highest mortality in the world , about 17 million people die from CVD each year. It is estimated that the people who are disabled by it, including the disability caused by myocardial infarction and stroke, are also topped by CVD. The continuous rise of CVD morbidity and mortality at home and abroad and the serious lack of options for treatment make the research on thrombosis drugs a hot topic. Whether in developed countries or in developing countries, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N9/68C12R1/84
Inventor 刘堰苏畅石小花宋小双聂盼肖明春
Owner SOUTHWEST UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com