Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vector of uPA expression regulated by Tet-on system and application thereof

A eukaryotic expression vector and tetracycline technology, which can be used in the introduction of foreign genetic material using vectors, recombinant DNA technology, animal husbandry, etc., and can solve problems such as liver damage

Inactive Publication Date: 2011-01-19
MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, uPA plays an important role in tissue damage and repair, such as uPA plays an important role in liver repair, but its overexpression in transgenic mice caused severe liver damage in neonatal mice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector of uPA expression regulated by Tet-on system and application thereof
  • Vector of uPA expression regulated by Tet-on system and application thereof
  • Vector of uPA expression regulated by Tet-on system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, transgenic vector pTRE 2 -uPA-711 vector construction and identification:

[0046] 1. Transgenic vector pTRE 2 - uPA-711 vector construction

[0047] Total RNA was extracted from kidney tissue of wild-type C57BL / 6J mice according to conventional molecular cloning methods, and 1302bp of the mouse uPAcDNA coding region sequence was amplified by reverse transcription PCR. Primers are uPAcDNA-F, uPAcDNA-R. uPAcDNA-F:cg ggatcc atgaaagtctggctggcgagcctg (introduce BamHI);

[0048] uPAcDNA-R:cg gtcgac catcagaaggccagacctttctcttc (introduced into SalI).

[0049] The reverse transcription conditions are:

[0050] PCR conditions: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute and 20 seconds, 30 cycles of 2-4 steps; 10 minutes at 72°C, 5 minutes at 4°C.

[0051] Cloning into pTRE 2 The recombinant vector was obtained from the vector, and the recombinant vector was ...

Embodiment 2

[0060]Example 2, Preparation and identification of tetO-uPA transgenic mice

[0061] 1. Preparation and PCR identification of the first tetO-uPA transgenic mice

[0062] pTRE 2 - The uPA-711 plasmid was digested with PvuⅠ, the 5739bp linearized fragment was recovered from agarose gel, and the fertilized eggs of C57×CBA F1 mice (the female parent was CBA mice, the male parent was C57 mice, both were purchased from Huafu, Beijing) Biotechnology Co., Ltd.) cell prokaryotic DNA microinjection, the injected eggs were transplanted into the fallopian tubes of pseudopregnant mother mice, and about 0.5 cm mouse tail was cut from the transgenic mice at the second week after birth, and the genomic DNA was extracted. Design a pair of primers for PCR identification, the schematic diagram and sequence of primer design are as follows: Figure 6 As shown, the primer sequences are as follows:

[0063] Upstream sequence primers: (Positive mice should be amplified to obtain a 465bp fragment) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an effect vector of uPA expression regulated by a Tet-on system. The nucleotide sequence of the effect vector comprises a bacteria tetracycline drug-resistant operon sequence, an immediate early promoter sequence of macrophages, a mice pro-urokinase activator expression cassette sequence and a sequence behind the last exon of the mice pro-urokinase activator expression cassette, the four sequences are serially connected in turn. The invention establishes a transgenic mice model of uPA expression regulated by the Tet-on system or tetracycline derivative inducible expression system, and lays solid foundation for further establishing a transgenic animal model of tissue specificity regulatable expression uPA for uPA function research in specific tissues.

Description

technical field [0001] The invention relates to a carrier for regulating the expression of uPA by a tetracycline-induced expression system and its application in a transgenic mouse model for establishing a tetracycline-induced expression system for regulating the expression of uPA. Background technique [0002] uPA (urokinase-plasminogen activator), the urokinase-type plasminogen activator, belongs to the serine proteolytic enzyme family, uPA catalyzes the conversion of plasminogen into plasmin, and starts the cascade reaction of fibrin and extracellular matrix proteolysis . In general, uPA is mainly involved in cell differentiation, migration, tissue reconstruction, extracellular matrix degradation, tumor invasion and metastasis under physiological and pathological conditions. The main components of the uPA fibrinolytic pathway include uPA, uPA receptor (urokinase plasminogen activator receptor, uPAR) and its type I inhibitor (plasminogen activator inhibitor-1, PAI-1) (Nic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N15/85A01K67/027
Inventor 周育森孙世惠周小军肖文珺胡婧雅于虹郭彦
Owner MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com