Vector of uPA expression regulated by Tet-on system and application thereof
A eukaryotic expression vector and tetracycline technology, which can be used in the introduction of foreign genetic material using vectors, recombinant DNA technology, animal husbandry, etc., and can solve problems such as liver damage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1, transgenic vector pTRE 2 -uPA-711 vector construction and identification:
[0046] 1. Transgenic vector pTRE 2 - uPA-711 vector construction
[0047] Total RNA was extracted from kidney tissue of wild-type C57BL / 6J mice according to conventional molecular cloning methods, and 1302bp of the mouse uPAcDNA coding region sequence was amplified by reverse transcription PCR. Primers are uPAcDNA-F, uPAcDNA-R. uPAcDNA-F:cg ggatcc atgaaagtctggctggcgagcctg (introduce BamHI);
[0048] uPAcDNA-R:cg gtcgac catcagaaggccagacctttctcttc (introduced into SalI).
[0049] The reverse transcription conditions are:
[0050] PCR conditions: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute and 20 seconds, 30 cycles of 2-4 steps; 10 minutes at 72°C, 5 minutes at 4°C.
[0051] Cloning into pTRE 2 The recombinant vector was obtained from the vector, and the recombinant vector was ...
Embodiment 2
[0060]Example 2, Preparation and identification of tetO-uPA transgenic mice
[0061] 1. Preparation and PCR identification of the first tetO-uPA transgenic mice
[0062] pTRE 2 - The uPA-711 plasmid was digested with PvuⅠ, the 5739bp linearized fragment was recovered from agarose gel, and the fertilized eggs of C57×CBA F1 mice (the female parent was CBA mice, the male parent was C57 mice, both were purchased from Huafu, Beijing) Biotechnology Co., Ltd.) cell prokaryotic DNA microinjection, the injected eggs were transplanted into the fallopian tubes of pseudopregnant mother mice, and about 0.5 cm mouse tail was cut from the transgenic mice at the second week after birth, and the genomic DNA was extracted. Design a pair of primers for PCR identification, the schematic diagram and sequence of primer design are as follows: Figure 6 As shown, the primer sequences are as follows:
[0063] Upstream sequence primers: (Positive mice should be amplified to obtain a 465bp fragment) ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


