Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof

An oxyntomodulin and fusion protein technology, applied in the field of treatment of metabolic diseases such as diabetes and obesity, can solve problems such as poor in vivo stability, and achieve the effects of good stability, easy to scale up production and low cost

Inactive Publication Date: 2011-04-13
曹鹏 +1
View PDF2 Cites 50 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, oxyntomodulin has shown potential as a therapeutic means for metabolic diseases such as diabetes and obesity, however, because of the poor stability of OXM in vivo, it is necessary to develop drugs that can be safely and effectively administered for the treatment of metabolic diseases such as diabetes and obesity. Long-acting OXM for obesity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof
  • Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof
  • Recombinant oxyntomodulin (OXM) fusion protein, and preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Obtaining OXM target gene and human IgG1 Fc fragment gene

[0051] According to the OXM gene sequence, its amino acid sequence is SEQ ID NO: 1, and its gene sequence is SEQ ID NO: 2, which was submitted to Gene Synthesis Company for synthesis. According to the human IgG1 Fc gene sequence, using normal human lymphocyte total RNA as a template, RT-PCR amplifies the IgG1 Fc fragment. The reaction conditions are as follows: After the RT-PCR reaction mixture is denatured at 50°C for 30 minutes, the reaction is carried out according to the following conditions: reverse Recording reaction: denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 68°C for 1 minute, 10 cycles of reaction. PCR reaction: Denaturation at 94°C for 30 seconds; annealing at 60°C for 30 seconds; extension at 68°C for 1 minute, 25 cycles of reaction. It was then extended for an additional 12 minutes at 68°C. After the reaction was completed, RT-PCR products were...

Embodiment 2

[0052] Embodiment 2: Construction of recombinant plasmid

[0053] The vector is constructed as figure 1 As shown, the OXM and Fc gene sequences were assembled by over-lap PCR technology; the mouse Igκ signal peptide was connected to the amino terminal of the OXM-Fc sequence by three PCRs using primer extension PCR technology; and the target gene was combined with pcDNA3.0 The plasmids were digested with Hind III and EcoR V endonucleases respectively; the digested products were ligated with T4 ligase, and the constructed plasmid was named pcDNA3.0 / OXM-Fc. specifically is:

[0054] 1.1 Design the following primers according to the OXM and human IgG1 Fc (hinge+ CH2+ CH3) cDNA sequences:

[0055] POXM1: 5'CATGGCGAGGGCACCTTCACCTC 3'

[0056] POXM2: 5' CAGGTGTGGGTCTTGTCAGAGGAC TTGGGC3'

[0057] PFc1: 5' GTCCTCTGACAAGACCCACACCTG 3'

[0058] PFc2: 5' CGCGGATCC TCACTTGCCGGGGCTCAGGGACAG3'

[0059] Among them, the italic part of POXM2 and PFc1 is the complementary region,...

Embodiment 3

[0065] Example 3: Screening and Identification of CHO Stable Expression Strains (CHO-OXM Cells)

[0066] 1) Take 10 ug of the pOXM-Fc plasmid prepared in Example 2 in large quantities, and use liposome Lipofectin2000 to transfect CHO cells. Two days later, passaging at a ratio of 1:5, adding 0.4 mg / ml G418 for selection, clonal formation can be seen in 10 days. Randomly digest 50 single clones with clear margins and good cell state and inoculate them in 24-well plate culture (the first round of screening).

[0067] 2) Please use ELISA to detect the expression of the fusion protein on the three-day culture, and select 15 clones with positive expression and inoculate them in 24-well plates (second round of screening) and 6-well plates (for seed preservation). After 4 days of culture, the supernatant was taken to detect the expression of the fusion protein by ELISA, and four clones with higher expression were selected: A5-3, B2-3, B2-5, and C1-4 were screened by limiting dilut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to long-acting and stable oxyntomodulin (OXM). An Fc segment of human immunoglobulin G and the human OXM form fusion protein through a connecting peptide. A method for preparing the fusion protein comprises the following steps of: preparing the human OXM and an Fc segment gene of the human immunoglobulin respectively, and connecting the human OXM and the Fc segment gene of the human immunoglobulin to construct connecting segment-containing recombinant expression vectors; and transforming host cells by using the recombinant expression vectors, culturing the host cells and recovering from cell culture and purifying the host cells to obtain the recombinant fusion protein. The fusion protein can be used for preparing medicaments for treating metabolic diseases such as diabetes and obesity.

Description

technical field [0001] The present invention relates to the construction of a long-acting and stable oxyntomodulin and its use in treating metabolic diseases such as diabetes and obesity. Background technique [0002] The regulation of human appetite and energy metabolism is mainly controlled by the hypothalamus, brainstem solitary tract nucleus, insulin, adiponectin, leptin and other islets, fat metabolism signal molecules, gastric growth hormone, glucagon-like peptide, gastrin regulation hormone, etc. Gastrointestinal hormones and the vagus nerve to regulate together. The hormones, neurotransmitters and fat metabolism signal molecules secreted by the hypothalamus and the nucleus of the solitary tract of the brain need to work through the nervous system and the blood circulation system. The weight-loss drugs targeting these regulatory pathways need to work through the central nervous system, affecting facial expression. Big, with serious side effects. Only gastrointestina...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K1/22C07K1/16C12N15/62C12N15/63A61K38/22A61K47/48A61P3/04A61P3/10A61K47/42
CPCA61K38/00C07K14/605C07K2319/30
Inventor曹鹏夏志南高健蔡雪婷卢悟广
Owner曹鹏