ELISA kit for detecting trace environment endocrine disruptor effect and application thereof
An endocrine disruptor and kit technology, which is used in biological testing, material testing products, and microbial determination/inspection, can solve problems such as poor accuracy and sensitivity, unstable cell culture, and large system errors, which are expensive to achieve. , Shorten the experimental period, the effect of easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Preparation of primary antibody-coated polystyrene microtiter plates
[0030] Rinse the polystyrene ELISA plate three times with double distilled water and dry it for later use. Anti-phospho-Serine specific monoclonal antibody (anti-phospho-Ser 167 ) after 1:100 dilution, take 100 ul into the microtiter plate, seal the plate, and coat at 4°C. Discard the coated antibody solution, and wash the plate 5 times with the washing solution, 3 minutes each time. Pat the ELISA plate dry on a paper towel, add 350ul of blocking solution to each well, seal the plate, and block overnight at 4°C. Discard the blocking solution, wash 5 times with the washing solution, 3 minutes each time, vacuum-dry the microplate, seal it into a metal foil bag with a desiccant, and store it at 4 °C. Wherein, the coating buffer is a carbonic acid buffer at pH 9.6, containing 15 mmol / L sodium carbonate (Na 2 CO 3 ), 35 mmol / L sodium bicarbonate (NaHCO 3 ); the blocking solution is a PBS...
Embodiment 2
[0031] Example 2 Preparation of biotin-labeled double-stranded DNA probe
[0032] synthesis 5’ DNA probe positive strand labeled with biotin: 5’-Biotin- ggCTggCCggCgTggAAgTTTggTCTggCTCACTgCAgg ggTCA Agg TgACC CCCggggTCACTTgT
[0033] CTAAAAgggATggTTTgTggg-3', represented by SEQ No1; Synthesizing its complementary chain is 5’- CCCACAAACCATCCCTTTTAGACAAGTGACCCCGGGGGTCACCTTGACCCCCTGCAGTG AGCCAGACCAAACTTC CACGCCAGGCCAGCC - 3', represented by SEQ No2. Sequences were labeled and synthesized by Shanghai Bioengineering Co., Ltd. Use annealing buffer (10 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH=8.0) to dissolve the positive strand and its complementary strand of the DNA probe to a final concentration of 20-100 umol / L. Mix the two strands equimolarly, incubate at 94°C for 5 minutes, then at 45°C for 5 minutes, cool to room temperature, purify the double-stranded DNA probe by SDS-PAGE, measure the concentration, dilute the probe with TE to a concentration of 5ng / ul , into a 1....
Embodiment 3
[0034] Example 3 Dose-effect curve drawing of standard estradiol
[0035] Using estradiol E2 as a standard product, use the kit of the present invention to detect, observe the binding capacity of estradiol, and draw a standard dose-effect curve. Include the following steps:
[0036] (1) Dilute the standard with binding buffer to 1×10 -6 mol / L~1×10 -12 mol / L total of 7 gradients.
[0037] (2) Dilute estrogen receptor protein with binding buffer to 2×10 -9 mol / L; the estrogen receptor protein was purchased from Sigma Reagent Company, USA.
[0038] (3) Dilute the 10× concentrated washing solution with deionized water to make 1× washing solution.
[0039] (4) Receptor ligand binding in vitro: a total volume of 100ul, which contains 50ul of the standard and 50ul of estrogen receptor diluted in step (2), and incubated at 4°C for 1 hour with shaking to form a ligand-receptor Complex.
[0040] (5) Receptor phosphorylation and probe binding: add 20ul of enzyme mixture I t...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com