ELISA kit for detecting trace environment endocrine disruptor effect and application thereof

An endocrine disruptor and kit technology, which is used in biological testing, material testing products, and microbial determination/inspection, can solve problems such as poor accuracy and sensitivity, unstable cell culture, and large system errors, which are expensive to achieve. , Shorten the experimental period, the effect of easy operation

Inactive Publication Date: 2011-05-18
THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since EDCs usually exist in the form of trace mixtures, and there are a large number of natural or synthetic chemicals in the environment, as of November 21, 2010, they have been registered in the American Chemical Abstracts Service (CAS) There are 62,287,480 natural or synthetic chemicals (http: / / www.cas.org / cgi-bin / cas / regreport.pl. 2010-11-21), in the face of so many chemicals, traditional The extraction and enrichment, high performance liquid chromatography / mass spectrometry / gas chromatography and other methods to separate a single component and determine the content of the test method can no longer meet the demand, so it is necessary to explore a high-throughput and cheap screening method
[0005] In 1998, the U.S. Environmental Protection Agency (U.S. EPA) launched the "Environmental Endocrine Disruptor Screening Program" (U.S.EPA, 1998; Federal Register, 63: 71542-71568 .); In 1997, Gaido et al. established an environmental estrogen yeast evaluation system (Gaido K W, et al. Toxicol Appl Pharmacol, 1997, 143(1): 205-212); Kim et al. (Kim SB, et al . Anal Sci. 2003, 19: 499-504) prepared a fluorescent-ER EDCs array slide screening technology, which is based on the idea of ​​high throughput, but there is still a long cycle , the instability of cell culture and other limitations, which make these methods low throughput, long cycle, large system error, poor accuracy and sensitivity, only semi-quantitative, and the EDCs in the sample may also be degraded by cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ELISA kit for detecting trace environment endocrine disruptor effect and application thereof
  • ELISA kit for detecting trace environment endocrine disruptor effect and application thereof
  • ELISA kit for detecting trace environment endocrine disruptor effect and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Preparation of primary antibody-coated polystyrene microtiter plates

[0030] Rinse the polystyrene ELISA plate three times with double distilled water and dry it for later use. Anti-phospho-Serine specific monoclonal antibody (anti-phospho-Ser 167 ) after 1:100 dilution, take 100 ul into the microtiter plate, seal the plate, and coat at 4°C. Discard the coated antibody solution, and wash the plate 5 times with the washing solution, 3 minutes each time. Pat the ELISA plate dry on a paper towel, add 350ul of blocking solution to each well, seal the plate, and block overnight at 4°C. Discard the blocking solution, wash 5 times with the washing solution, 3 minutes each time, vacuum-dry the microplate, seal it into a metal foil bag with a desiccant, and store it at 4 °C. Wherein, the coating buffer is a carbonic acid buffer at pH 9.6, containing 15 mmol / L sodium carbonate (Na 2 CO 3 ), 35 mmol / L sodium bicarbonate (NaHCO 3 ); the blocking solution is a PBS...

Embodiment 2

[0031] Example 2 Preparation of biotin-labeled double-stranded DNA probe

[0032] synthesis 5’ DNA probe positive strand labeled with biotin: 5’-Biotin- ggCTggCCggCgTggAAgTTTggTCTggCTCACTgCAgg ggTCA Agg TgACC CCCggggTCACTTgT

[0033] CTAAAAgggATggTTTgTggg-3', represented by SEQ No1; Synthesizing its complementary chain is 5’- CCCACAAACCATCCCTTTTAGACAAGTGACCCCGGGGGTCACCTTGACCCCCTGCAGTG AGCCAGACCAAACTTC CACGCCAGGCCAGCC - 3', represented by SEQ No2. Sequences were labeled and synthesized by Shanghai Bioengineering Co., Ltd. Use annealing buffer (10 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH=8.0) to dissolve the positive strand and its complementary strand of the DNA probe to a final concentration of 20-100 umol / L. Mix the two strands equimolarly, incubate at 94°C for 5 minutes, then at 45°C for 5 minutes, cool to room temperature, purify the double-stranded DNA probe by SDS-PAGE, measure the concentration, dilute the probe with TE to a concentration of 5ng / ul , into a 1....

Embodiment 3

[0034] Example 3 Dose-effect curve drawing of standard estradiol

[0035] Using estradiol E2 as a standard product, use the kit of the present invention to detect, observe the binding capacity of estradiol, and draw a standard dose-effect curve. Include the following steps:

[0036] (1) Dilute the standard with binding buffer to 1×10 -6 mol / L~1×10 -12 mol / L total of 7 gradients.

[0037] (2) Dilute estrogen receptor protein with binding buffer to 2×10 -9 mol / L; the estrogen receptor protein was purchased from Sigma Reagent Company, USA.

[0038] (3) Dilute the 10× concentrated washing solution with deionized water to make 1× washing solution.

[0039] (4) Receptor ligand binding in vitro: a total volume of 100ul, which contains 50ul of the standard and 50ul of estrogen receptor diluted in step (2), and incubated at 4°C for 1 hour with shaking to form a ligand-receptor Complex.

[0040] (5) Receptor phosphorylation and probe binding: add 20ul of enzyme mixture I t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an enzyme-linked immunosorbent assay (ELISA) kit for detecting trace environmental endocrine disruptor effect and application thereof. The kit comprises a probe, protein, binding buffer solution, an ELISA plate, enzyme mixed liquor I, enzyme mixed liquor II, color developing solution, stop solution, 10*concentrated cleaning solution, and a standard substance. The probe isdouble stranded deoxyribonucleic acid (DNA) marked by biotin for a 5' end; the protein is a recombinant human estrogen receptor; the ELISA plate coats a Ser167 phospho-estrogen receptor monoclonal antibody; and the enzyme mixed liquor I contains two phosphorylating enzymes. By comparing with a standard dosage and effect curve of estradiol, the accumulated estrogenic effect of the environmental endocrine disruptor relative to the estradiol in a sample is determined. The kit is convenient and easy to operate at a high speed, has high flux, and can be widely used in the fields of environment andfood detection and the like.

Description

technical field [0001] The invention relates to the application field of detecting the effects of trace environmental endocrine disruptors, in particular to an ELISA kit for detecting the effects of trace environmental endocrine disruptors based on the principle of estrogen receptor mediation and its application. Background technique [0002] In recent years, with the continuous increase of industrial pollution, environmental endocrine disrupting compounds (Endocrine disrupting compounds, EDCs) have become the third generation of environmental pollutants after the soot pollution brought by the industrial revolution and the photochemical smog pollution brought by the development of the automobile industry. , will have a serious impact on human health. EDCs are mainly polychlorinated biphenyls, dioxins, alkylphenols, phthalates, agrochemicals, natural or synthetic hormone drugs and other estrogen-like substances, which can simulate natural estrogen in the body Competitive bin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/74C12Q1/68C12Q1/28C12Q1/25
Inventor 邓国宏谭文婷王莎莎
Owner THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap