TGase-activating protease inhibitor producing engineering bacteria and construction method thereof

A technology for producing transglutaminase and transglutaminase, which is applied in the field of genetic engineering, can solve problems such as inability to exhibit surface active functions, and achieve the effects of easy separation and purification, high product yield, and simple production process

Active Publication Date: 2011-06-01
TAIXING DONGSHENG FOOD TECH
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, most natural proteins cannot exhibit their surface active function because the non-polar groups are wrapped inside the dense and stable protein molecules.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Acquisition of TGase-activated protease inhibitor (TAPI) gene

[0027] According to the N-amino acid sequencing results of TGase-activated protease inhibitors, the 5'-terminal primer was designed: 5'-GGCCTCTACGCCGCCACG-3'; the conserved sequence of amino acids in the SSI protein family was analyzed, and the relatively conservative amino acid was selected to design the 3'-terminal primer: 5'-GCGCTTGCCCTGCCAGACG- 3', the sequence of the middle segment of the TAPI gene is obtained as shown in SEQ ID NO.3.

[0028] GGCCTCTACGCCGCCACGGCACTGGTGCTGACGGCCGGCCAGGGCGAAAGCCGCGCGACCGCCACGGTGCAGCGCGCCGTGACGCTCAGCTGTATGCCGGGGGCGACCGGCAGCCACCCGAACCCGAAAGCCGCCTGCGCCGAACTGCGCACGGCGGCCGGTGACTTCAACGCGGTGACCACTGCCCCGTCCGACCGGCTGTGCACCAAGGAGTGGAACCCCTTCGTGGTCACCGCCGACGGCGTCTGGCAGGGCAAGCGC

[0029] Design reverse primers according to the above sequence: 5'-CGGCATACAGCTGAGCGTCACGGCG-3', 5'-CACCAAGGAGTGGAACCCCTTCGTGGTCA-3'; select Xho I Endonuclease, digestion of the genome of Str...

Embodiment 2

[0034] Embodiment 2: Construction of recombinant plasmid pET22b(+)-TAPI

[0035] The vector containing the sequence of SEQ ID NO. 1 and the expression vector pET22b (+) were respectively carried out NCOI and HindⅢ After double enzyme digestion, Takara's Solution I was used for connection after recovery. The ligation reaction system was (10 μL): 4 μL of target gene fragment, 1 μL of carrier DNA, and 5 μL of SolutionI.

[0036] The ligation product was transformed into competent Escherichia coli JM109 for transformation. The conversion method is as follows:

[0037] ⑴ Take the competent form out of the ultra-low temperature refrigerator and put it on ice to melt. Add 10ul of linking solution to 100ul of competent cells, add the tip of the pipette into the cell solution, and flick with your fingers to mix.

[0038] (2) Place the competent and transformed DNA on ice for 30 minutes to allow the DNA to fully adsorb to the cell surface.

[0039] (3) Shock in a water bath at...

Embodiment 3

[0044] Example 3: Construction of TGase-activated protease inhibitor (TAPI) genetically engineered bacteria

[0045] Extract the plasmid from the above-mentioned positive transformant liquid culture, add 2-5uL purified plasmid into Bl21(DE3) competent medium for transformation, the specific method is similar to transforming JM109, but BL21(DE3) expresses the host, the transformation efficiency is low, and the plasmid copy number is low. The growth rate of transformants is slow, and it takes 10 hours to 14 hours, or even longer, to grow colonies. The culture needs to be further extended at night, but if you are worried about the overgrowth of the cells, you can culture the transformation plate in a 30°C incubator.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses TGase-activating protease inhibitor (TAPI) producing engineering bacteria and a construction method thereof and belongs to the field of genetic engineering. In the invention, the complete gene sequence of TAPI in Streptomyceshygroscopicus is obtained for the first time by a molecular biological means, a recombinant plasmid pET22b(+)-TAPI is constructed according to the obtained sequence, the TAPI is expressed in Escherichia coli, and when the bacteria are used for producing TAPI, the yield can reach 10mg / L. The method has the advantages of simple process, high product yield and the like, and a safe, mild and green novel protein surfactant is developed; and the target protein produced by the strain can be secreted outside cells directly, so it is easy to separate and purify the target protein. The invention provides a reference and basis for the genetic expression of protein surfactants and exploits a new direction for the development of the protein surfactants.

Description

technical field [0001] The invention relates to a genetically engineered bacterium producing a transglutaminase (TGase) activated protease inhibitor and a construction method thereof, belonging to the field of genetic engineering. Background technique [0002] Proteins are generally composed of hydrophobic amino acid groups and hydrophilic amino acid groups. Due to the balance of alanine amino acid groups, proteins show surface activity. Due to the irregularity or specificity of the distribution of polar or non-polar amino acids in each protein peptide chain, as well as the influence of protein spatial structure and spatial structural forces such as disulfide bonds, etc. Therefore, most natural proteins cannot exhibit their surface active function because the non-polar groups are wrapped in the dense and stable protein molecules. However, in some segments of the polypeptide chain of some proteins, there will be a structure with a polar amino acid residue accumulation region...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/70C12P21/02C12R1/55
Inventor陈坚堵国成马腾博张东旭
OwnerTAIXING DONGSHENG FOOD TECH