Fluorescent polymerase chain reaction (PCR) kit for detecting chlamydia trachomatis infection by SYBR Green method
A Chlamydia trachomatis and kit technology, applied in the direction of fluorescence/phosphorescence, microbial measurement/inspection, biochemical equipment and methods, etc., can solve problems such as unsuitable for clinical application, time-consuming and expensive, and complicated experimental methods, and achieve DNA Specific spectroscopic technology for hybridization, simple operation steps, and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: the preparation of kit
[0035] 1. Primer design and synthesis
[0036] Use Primer premier5.0 to design upstream and downstream primers for the major outer membrane protein gene of CT (studies have shown that the outer membrane major protein gene has excellent specificity). The primers were synthesized by a professional company (Shenggong), and the primers were purified by PAGE. The amplified sequence is shown in Table 1:
[0037] Table 1. Specific primer sequences
[0038] sequence name
Oligonucleotide sequence (5'-3')
Base length (bp)
CCATGAGTGGCAAGCAAGTTTAGC
24
CAGCGATGGTCGGGTTTAGAG
21
[0039] 2. Preparation of CT plasmid positive reference substance
[0040] In this example, the CT plasmid was used as a positive template for the positive control.
[0041] According to the primers for amplifying the CT-specific sequences synthesized in step 1, select a sequ...
Embodiment 2
[0046] Embodiment 2: the use of kit
[0047] 1. Sample extraction
[0048] Use the DNA extraction solution to extract the CT virus nucleic acid in the sample to be tested
[0049] 1) Sample pretreatment: wipe off excess secretions from the cervix, use a cotton swab soaked in normal saline to cling to the cervical mucous membrane and rotate it for 2 weeks to obtain secretions and exfoliated cells, and put the cotton swab after sampling Rinse fully in an EP tube with 1ml of sterile saline, and squeeze dry by sticking to the wall. The CT virus was extracted by alkaline lysis.
[0050] Lysis solution formula: 60mmol / L TrisHCl, pH 8.0; 0.5% SDS; 200mmol / L NaCl;
[0051] 2) Operation steps: Take 500 μl of secretions, mix and centrifuge at 13,000 rpm for 10 minutes, discard the supernatant; add 50 μl of lysate, incubate at 100°C for 20 minutes, centrifuge at 13,000 rpm for 1 minute, and take 1 μl of the supernatant for PCR reaction.
[0052] 2. Preparation of CT positive control ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 