Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof

A transgenic and recombinant gene technology, applied in the direction of hormone receptors, biochemical equipment and methods, botany equipment and methods, etc., can solve the problems of inconsistency in effects, etc., to achieve high activity of signaling pathways and significant growth-promoting effects of transgenes Effect

Inactive Publication Date: 2013-05-01
INST OF AQUATIC LIFE ACAD SINICA
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the negative feedback effect of the GH signaling pathway and the diverse genetic backgrounds of the tested fish, the growth-promoting effect caused by exogenous GH gene transfer is not consistent in different fish (Devlin, R.H., C.A. Biagi, et al. (2001). "Growth of domesticated transgenic fish." Nature 409(6822):781-782 Devlin, R.H., D. Sakhrani, et al. (2009). "Domestication and growth hormone transgenesis cause similar changes in gene expression in coho salmon (Oncorhynchus kisutch)." Proc Natl Acad Sci U S A 106(9):3047-3052.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof
  • Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof
  • Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Molecular Design of Recombinant Protein of Continuously Activated Recombinant Growth Hormone Receptor

[0058] Prediction by protein structure ( http: / / swissmodel.expasy.org / / SWISS-MODEL.html )SWISS-MODEL program and protein structure analysis ( http: / / swissmodel.expasy.org / spdbv / ) The Swiss-PdbViewer program, based on our deep understanding of the GHR signaling pathway in the early stage, molecularly designed a continuously activated recombinant growth hormone receptor molecule:

[0059] 1) Carp GHR signal peptide:

[0060] MAYSLSLGLLYLGLLCGNGLVSARSE

[0061] 2) Carp c-Jun leucine zipper area:

[0062] RIKAERKRLRNRLAATKCRKRKLERISRLEEKVKVLKNDNAGLSNTASVLRDQVAQLKQKVLR

[0063] 4) Transmembrane and intracellular regions of carp GHR:

[0064] VAQIPSKESTFPTTLVLIFGVIGVVILLVLLIFSQQQRLMVIFLPPIPAPKIKGIDPELLKNGKLDQLNSLLSSQDMYKPDFYHEDPWVEFIQLDLDDPAEKNESSDTQHLLGLSRSGSSHFLNFKSDNDSGRASCYDPEIPNPKDLASFLPGHSGRGDNHPLVSRSSSSIPDLGFQQTSEVEETPIQTQPAVPSWVNMDFYAQVSDFTPAGGVVLSPGQLNSSPVKKKGEGNEKKIQFQLLS...

Embodiment 2

[0067] Preparation of continuously activated GHR recombinant gene

[0068] 1) Primer design.

[0069] Primers for amplifying GHR signal peptide:

[0070] F: CAGATCGATCACCCGGGAGCCACCATGGCTTACTCTCTCTCGCTC

[0071] R:TTTCCGCCTTGATGCGCTCGGATCTTGCAGACACCAG

[0072] Primers for amplifying the zipper region of c-Jun:

[0073] F:CAAGATCCGAGCGCATCAAGGCGGAAAGGAAGAG

[0074] R: CTTGGTATCTGTGCCACTCTCAGGACTTTCTGTTTGAGTTG

[0075] Primer for amplifying GHR signal transmission region:

[0076] F: CCTGAGAGTGGCACAGATACCAAGCAAAG

[0077] R: GTTCTCGAGATTCATGGGTTCAGGTTTCCCAGAAG

[0078] 2) The GHR signal peptide, c-Jun leucine zipper region, GHR transmembrane region and intracellular region are respectively amplified by PCR.

[0079] GHR signal peptide amplification conditions are: 95°C pre-denaturation for 4 minutes; 95°C denaturation for 30 seconds, 66°C renaturation for 30 seconds, 68°C extension for 30 seconds, 13 cycles; 68°C extension for 10 minutes ; Store at 4°C.

[0080] The amplification conditions of c...

Embodiment 3

[0087] Application of a continuously activated growth hormone receptor gene in zebrafish.

[0088] 1) Preparation of transgenic zebrafish:

[0089] Taking zebrafish as the object, prepare transgenic zebrafish that continuously activate GHR gene. After the expression vector pCA-SJG-AT is extracted with plasmid mini preparation kit (Axygen), it is dissolved in ST solution (88mmol / l NaCl, 10mmol / l Tris-HCl, pH 7.5), and its final concentration is adjusted 85ng / μl, using microinjection method (Zhu Z, Li G, He L, et al. Novel gene transfer into the fertilized eggs of goldfish (Carassius auratus L. 1758). Z angew Ichthyol, 1985, 1:31 -34), before the first cleavage, the DNA solution is introduced into the zebrafish fertilized egg animal pole, the DNA injection dose is 1-2nl / egg, and the fertilized egg is incubated and cultured at a water temperature of 28.5℃ after completing the micromanipulation.

[0090] 2) Screening of fast-growing fish with continuous activation of GHR gene:

[0091] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a continuously activated growth hormone receptor gene of fishes, and a preparation method and application thereof. The preparation method comprises the following steps of: respectively performing polymerase chain reaction (PCR) amplification on growth hormone receptor (GHR) signal peptide, a c-Jun leucine zipper region, a GHR transmembrane region and an intracellular region of carp, and combining another turn of bridge-PCR amplification to obtain a continuously activated GHR recombinant gene segment; and cloning the obtained recombinant gene into an expression vector pCA-AT to obtain a recombinant gene vector pCA-SJG-AT for gene transfer. A protein encoded by the gene has the amino acid sequence shown as SEQIDNO:1; and a separated recombinant gene has the nucleotide sequence shown as SEQIDNO:2. The application of the recombinant gene in quick growth of transgenic fish has the advantages that: (1) the activity of the recombinant GHR protein for promoting a signal channel is high, and the efficiency of the continuously activated GHR effect is more than 3 times higher than that of GH effect; and (2) the transgene of the continuously activated GHR gene has obvious growth promotion effect, and the transgenic fish has a growth speed which is over 50 percent higher than that of contrast fish.

Description

Technical field [0001] The present invention belongs to the technical field of genetic engineering breeding of aquatic economic animals. The present invention relates to a recombinant gene that continuously activates fish growth hormone signal pathways and promotes fish growth, as well as a method for preparing the recombinant gene, and also relates to a recombinant gene Use in fish genetic engineering breeding. Background technique [0002] Growth rate is one of the most important economic traits of aquaculture animals. With limited and increasingly scarce natural fishing resources, how to increase the growth rate and output of farmed fish has become an urgent topic. At the same time, increasing the growth rate of farmed fish can speed up the commercial fish market cycle and provide higher-quality new breeds of farmed fish, and improve economic benefits. Therefore, the development of new breeds of cultured fish with rapid growth effects through genetic engineering has importan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/72C12N15/12C12N15/10C12N15/63A01K67/033
Inventor孙永华朱作言熊凤伊斯提亚克迈克沃特斯
OwnerINST OF AQUATIC LIFE ACAD SINICA