Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof
A transgenic and recombinant gene technology, applied in the direction of hormone receptors, biochemical equipment and methods, botany equipment and methods, etc., can solve the problems of inconsistency in effects, etc., to achieve high activity of signaling pathways and significant growth-promoting effects of transgenes Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Molecular Design of Recombinant Protein of Continuously Activated Recombinant Growth Hormone Receptor
[0058] Prediction by protein structure ( http: / / swissmodel.expasy.org / / SWISS-MODEL.html )SWISS-MODEL program and protein structure analysis ( http: / / swissmodel.expasy.org / spdbv / ) The Swiss-PdbViewer program, based on our deep understanding of the GHR signaling pathway in the early stage, molecularly designed a continuously activated recombinant growth hormone receptor molecule:
[0059] 1) Carp GHR signal peptide:
[0060] MAYSLSLGLLYLGLLCGNGLVSARSE
[0061] 2) Carp c-Jun leucine zipper area:
[0062] RIKAERKRLRNRLAATKCRKRKLERISRLEEKVKVLKNDNAGLSNTASVLRDQVAQLKQKVLR
[0063] 4) Transmembrane and intracellular regions of carp GHR:
[0064] VAQIPSKESTFPTTLVLIFGVIGVVILLVLLIFSQQQRLMVIFLPPIPAPKIKGIDPELLKNGKLDQLNSLLSSQDMYKPDFYHEDPWVEFIQLDLDDPAEKNESSDTQHLLGLSRSGSSHFLNFKSDNDSGRASCYDPEIPNPKDLASFLPGHSGRGDNHPLVSRSSSSIPDLGFQQTSEVEETPIQTQPAVPSWVNMDFYAQVSDFTPAGGVVLSPGQLNSSPVKKKGEGNEKKIQFQLLS...
Embodiment 2
[0067] Preparation of continuously activated GHR recombinant gene
[0068] 1) Primer design.
[0069] Primers for amplifying GHR signal peptide:
[0070] F: CAGATCGATCACCCGGGAGCCACCATGGCTTACTCTCTCTCGCTC
[0071] R:TTTCCGCCTTGATGCGCTCGGATCTTGCAGACACCAG
[0072] Primers for amplifying the zipper region of c-Jun:
[0073] F:CAAGATCCGAGCGCATCAAGGCGGAAAGGAAGAG
[0074] R: CTTGGTATCTGTGCCACTCTCAGGACTTTCTGTTTGAGTTG
[0075] Primer for amplifying GHR signal transmission region:
[0076] F: CCTGAGAGTGGCACAGATACCAAGCAAAG
[0077] R: GTTCTCGAGATTCATGGGTTCAGGTTTCCCAGAAG
[0078] 2) The GHR signal peptide, c-Jun leucine zipper region, GHR transmembrane region and intracellular region are respectively amplified by PCR.
[0079] GHR signal peptide amplification conditions are: 95°C pre-denaturation for 4 minutes; 95°C denaturation for 30 seconds, 66°C renaturation for 30 seconds, 68°C extension for 30 seconds, 13 cycles; 68°C extension for 10 minutes ; Store at 4°C.
[0080] The amplification conditions of c...
Embodiment 3
[0087] Application of a continuously activated growth hormone receptor gene in zebrafish.
[0088] 1) Preparation of transgenic zebrafish:
[0089] Taking zebrafish as the object, prepare transgenic zebrafish that continuously activate GHR gene. After the expression vector pCA-SJG-AT is extracted with plasmid mini preparation kit (Axygen), it is dissolved in ST solution (88mmol / l NaCl, 10mmol / l Tris-HCl, pH 7.5), and its final concentration is adjusted 85ng / μl, using microinjection method (Zhu Z, Li G, He L, et al. Novel gene transfer into the fertilized eggs of goldfish (Carassius auratus L. 1758). Z angew Ichthyol, 1985, 1:31 -34), before the first cleavage, the DNA solution is introduced into the zebrafish fertilized egg animal pole, the DNA injection dose is 1-2nl / egg, and the fertilized egg is incubated and cultured at a water temperature of 28.5℃ after completing the micromanipulation.
[0090] 2) Screening of fast-growing fish with continuous activation of GHR gene:
[0091] ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com