Reconstruction method for producing Vitamin C precursor 2-keto-L-gulonic acid (2-KLG) with gluconobacter oxydans
A gluconic acid bacteria, 2-KLG technology, applied in the field of genetic engineering, can solve problems such as difficulty, prolong production cycle, increase production process, etc., and achieve the effect of simple construction method and simplified production process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0018] The construction of embodiment 1 expression vector
[0019] Design primers P1: 5'GGAATTCCATATGATGAAACCGACTTCGCTGCTTTGGGC3'; P2: 5'CGCGGATCCTTATTGCGGCAGGGCGAAGACGTAGA3', clone the sdh gene sequence of K. vulgare DSM4205 after amplification and clone it into the G. oxydans-E. coli shuttle plasmid vector pGUC1 to construct the expression vector pGUC1-sdh, After the constructed expression vector was transformed into Escherichia coli JM109, the transformants were selected, the plasmid was extracted and digested with NdeI and BamHI, a 1740bp band appeared, which proved that the expression vector pGUC1-sdh had been successfully constructed. Primers P3: 5'CGCGGATCCATGTTACCCAAATCATTGAAACATAAGA3'; P4: 5'CGAGCTCTCAGCGGG TGGCAGCGG3' were designed, and the sndh gene sequence annotated in the whole genome sequencing results of K. vulgare DSM4205 in our laboratory was amplified and cloned into the shuttle plasmid vector pGUC1 to construct The expression vector pGUC1-sdh-sndh, after tr...
Embodiment 2
[0020] The construction of embodiment 2G.oxydans engineering bacteria
[0021] The constructed expression vector was transformed into E.coli JM109. Since the recombinant plasmid carries the ampicillin resistance gene, transform E.coli JM109 competent, apply to LB containing ampicillin (yeast extract 5g / L, peptone 10g / L, NaCl 10g / L, solid medium plus 20g / L agar, adjust the pH to 7.0, and sterilize at 121°C for 15 minutes), pick the transformants that grow normally on the plate after transformation, and extract the plasmids for PCR verification. Bands of 1740bp and 1830bp appear respectively, and the same bands cannot be obtained by PCR in the control. It is proved that it has been successfully transformed into E.coli, and then the extracted plasmid is transformed into G.oxydans to obtain G.oxydans-pGUC1-sdh-sndh engineering bacteria.
Embodiment 3
[0022] Embodiment 3 fermentation produces 2-KLG
[0023] Seed and slant medium (g / L): sorbitol 20, yeast extract 2, calcium carbonate 0.4, pH 4.8-5.1, agar 20 (slant medium), pH 7.0, sterilized at 121°C for 15 minutes, final concentration of ampicillin 100 μg / mL.
[0024] Fermentation medium (g / L): sorbitol 80, yeast extract 5, calcium carbonate 0.2, initial pH 5.1-5.4, sterilized at 121°C for 15 minutes, final concentration of ampicillin 100 μg / mL.
[0025] Culture conditions: inoculate the recombinant bacteria from the slant into 20mL seed medium, culture at 30°C and 200rpm for 32h, then add 15% to the fermentation medium, and carry out shake flask fermentation at 34°C and 220rpm, and the fermentation period is 48h. The yield of 2-KLG was 52g / L.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com