Reconstruction method for producing Vitamin C precursor 2-keto-L-gulonic acid (2-KLG) with gluconobacter oxydans

A gluconic acid bacteria, 2-KLG technology, applied in the field of genetic engineering, can solve problems such as difficulty, prolong production cycle, increase production process, etc., and achieve the effect of simple construction method and simplified production process

A gluconic acid bacteria, 2-KLG technology, applied in the field of genetic engineering, can solve problems such as difficulty, prolong production cycle, increase production process, etc., and achieve the effect of simple construction method and simplified production process

CN102250822AInactive Publication Date: 2011-11-23JIANGNAN UNIV

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The construction of embodiment 1 expression vector

[0019] Design primers P1: 5'GGAATTCCATATGATGAAACCGACTTCGCTGCTTTGGGC3'; P2: 5'CGCGGATCCTTATTGCGGCAGGGCGAAGACGTAGA3', clone the sdh gene sequence of K. vulgare DSM4205 after amplification and clone it into the G. oxydans-E. coli shuttle plasmid vector pGUC1 to construct the expression vector pGUC1-sdh, After the constructed expression vector was transformed into Escherichia coli JM109, the transformants were selected, the plasmid was extracted and digested with NdeI and BamHI, a 1740bp band appeared, which proved that the expression vector pGUC1-sdh had been successfully constructed. Primers P3: 5'CGCGGATCCATGTTACCCAAATCATTGAAACATAAGA3'; P4: 5'CGAGCTCTCAGCGGG TGGCAGCGG3' were designed, and the sndh gene sequence annotated in the whole genome sequencing results of K. vulgare DSM4205 in our laboratory was amplified and cloned into the shuttle plasmid vector pGUC1 to construct The expression vector pGUC1-sdh-sndh, after tr...

Embodiment 2

[0020] The construction of embodiment 2G.oxydans engineering bacteria

[0021] The constructed expression vector was transformed into E.coli JM109. Since the recombinant plasmid carries the ampicillin resistance gene, transform E.coli JM109 competent, apply to LB containing ampicillin (yeast extract 5g / L, peptone 10g / L, NaCl 10g / L, solid medium plus 20g / L agar, adjust the pH to 7.0, and sterilize at 121°C for 15 minutes), pick the transformants that grow normally on the plate after transformation, and extract the plasmids for PCR verification. Bands of 1740bp and 1830bp appear respectively, and the same bands cannot be obtained by PCR in the control. It is proved that it has been successfully transformed into E.coli, and then the extracted plasmid is transformed into G.oxydans to obtain G.oxydans-pGUC1-sdh-sndh engineering bacteria.

Embodiment 3

[0022] Embodiment 3 fermentation produces 2-KLG

[0023] Seed and slant medium (g / L): sorbitol 20, yeast extract 2, calcium carbonate 0.4, pH 4.8-5.1, agar 20 (slant medium), pH 7.0, sterilized at 121°C for 15 minutes, final concentration of ampicillin 100 μg / mL.

[0024] Fermentation medium (g / L): sorbitol 80, yeast extract 5, calcium carbonate 0.2, initial pH 5.1-5.4, sterilized at 121°C for 15 minutes, final concentration of ampicillin 100 μg / mL.

[0025] Culture conditions: inoculate the recombinant bacteria from the slant into 20mL seed medium, culture at 30°C and 200rpm for 32h, then add 15% to the fermentation medium, and carry out shake flask fermentation at 34°C and 220rpm, and the fermentation period is 48h. The yield of 2-KLG was 52g / L.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reconstruction method for producing the Vitamin C precursor 2-KLG with gluconobacter oxydans, and belongs to the field of genetic engineering. According to the invention, a sorbose dehydrogenase (SDH) gene and a sorbosone dehydrogenase (SNDH) gene originated from ketogulonigenium vulgare are expressed in gluconobacter oxydans to obtain a G. oxydans engineering bacteria for production of 2-KLG by using sorbitol. G. oxydans is a frequently used strain in the first step of fermentation in the method of two-step fermentation; in the invention, the SDH and SNDH genes are expressed in G. oxydans, which enables the problem of dependency of ketogulonigenium vulgare on associated fungi to be overcome, direct conversion of D-sorbitol into 2-KLG to be realized and the production process for Vitamin C to be simplified; output of 2-KLG reaches 83 g / L; therefore, the invention has a very good application prospect.

Description

technical field [0001] The invention relates to a high-yielding 2-KLG gluconobacter oxidase engineering bacterium and a construction method thereof, which adopts molecular means to introduce SDH and SNDH to realize the production of 2-KLG by metabolizing sorbitol, and belongs to the field of genetic engineering. Background technique [0002] Vitamin C (Vitamin C, VC), also known as Ascorbic acid (Ascorbic acid), is an essential vitamin and antioxidant, widely used in medicine, food, feed and cosmetic industries. At present, the industrial production of vitamin C in China adopts a two-step fermentation method. In the second-step mixed-bacteria fermentation system, only small bacteria perform sugar-acid conversion. It is difficult for small bacteria to grow alone, and they need to be co-cultured with large bacteria to grow normally. The fermentation control of the two kinds of bacteria has added great difficulties to the production process, and the acid-producing properties of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
23 Nov 2011
Publication
CN102250822A
IPC
C12N1/21; C12N15/31; C12N15/63; C12P7/60; C12R1/01
Inventors
陈坚; 高丽丽