Duck viral enteritis virus vaccine strain infectious cloning system and its construction method and application

A duck viral enteritis and infectious cloning technology, which is applied in the field of viral vaccine strain infectious cloning, can solve the problems of unclear classification, heavy workload, and low efficiency

Active Publication Date: 2011-12-14
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF1 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for DEV, a virus whose basic research is lacking, its classification is unclear, and its non-essential genes are unknown, the workload and efficiency of constructing recombinant viruses using the first or second method are large
The difficulty of the third method lies in the establishment of polymysmid infectious clones. If this platform is successfully constructed, it will be able to quickly and effectively construct recombinant viruses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Duck viral enteritis virus vaccine strain infectious cloning system and its construction method and application
  • Duck viral enteritis virus vaccine strain infectious cloning system and its construction method and application
  • Duck viral enteritis virus vaccine strain infectious cloning system and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1. Construction of Genome Fosmid Library of DEV Vaccine Strain

[0029]The Fosmid library of the DEV genome was constructed according to the instructions of the "CopyControl Fosmid Library Production Kit" kit from EPICENTRE. The method is as follows, the DNA of the DEV vaccine strain virus (CVCC AV1222) (China Veterinary Microbiological Culture Collection Management Center, catalog number AV1222; purchased from the China Veterinary Drug Supervision Institute) was physically collected using a 25-gauge needle (purchased from Shanghai Zhiyu Medical) Instrument Co., Ltd.) was pumped several times for cutting, and the DNA fragments were terminated with T4 DNA Polymerase (purchased from New England Biolabs) and alkaline phosphatase (Alkaline Phosphatase) (purchased from New England Biolabs). Smoothing and dephosphorylation treatment, pulse electrophoresis (using Bio-Rad CHEF Mapper The XAPulsed Field system performs pulse electrophoresis. The conditions of pulse ele...

Embodiment 2

[0030] Example 2. Selection for rescue of DEV cosmids

[0031] After the library was successfully constructed, 286 clones were picked to extract the cosmids, and the alkaline lysis method was used to [12] Extract the cosmid and send it to Dalian Bao Biological Company to sequence the end of the DEV DNA fragment inserted into pCC1 Fos,

[0032] The sequencing primer sequences are as follows:

[0033] Primer 1: TAATACGACTCACTATAGGG

[0034] Primer 2: GCCAAGCTATTTAGGTGAGA

[0035] After terminal sequencing analysis, a total of 250 clones with complete FseI-SbfI-PmeI adapters connected to both ends of the insert fragment were obtained. Multiple sets of 5 cosmid combinations were selected from these 250 clones. Both ends of the DEV DNA fragments cloned in each group contain Fse I-Sbf I-Pme I joints, which can overlap each other and can be spliced ​​to cover the entire DEV genome.

Embodiment 3

[0036] Example 3. Virus rescue

[0037] The DNA of the selected cosmids was extracted with Qiagen's medium extraction kit. The selected cosmids were linearized with Fse I, Sbf I or Pme I endonuclease (both purchased from New England Biolabs), and the reaction conditions were as follows: 20 U of Sbf I endonuclease (Fse I or Pme I could also be used Endonuclease), cosmid 10 μg, acted at 37°C for 1 hour, extracted with phenol / chloroform, and precipitated with ethanol to prepare DEV DNA for transfection.

[0038] Refer to the calcium phosphate method of Reddy SM (2002) to co-transfect the second generation chicken embryo fibroblasts (CEF) with 5 segments of DEV DNA [9] After multiple repetitions, 3 groups of 5-cosmid combinations showed typical lesions of DEV virus after 4-6 days of transfection. A group of 5-cosmid combinations with good repeatability was selected for subsequent experiments. The position of the cosmid combination relative to the DEV genome is as follows image...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a duck viral enteritis virus infective cloned system, which is characterized in that the system comprises multiple cosmids, each cosmid possesses clone of a gene fragment of duck viral enteritis viral vaccine strain, the gene fragment of the duck viral enteritis viral vaccine strain contains a mutual overlapped area, and splices to cover the whole gene group of the duck viral enteritis viral vaccine strain. The invention also relates to a construction method and an application of the duck viral enteritis virus infective cloned system.

Description

technical field [0001] The present invention relates to the field of infectious cloning of virus vaccine strains, in particular to the field of infectious cloning of duck viral enteritis virus vaccine strains, more specifically to the infectious cloning system of duck viral enteritis virus vaccine strains and its construction method and application. Background technique [0002] Duck plague, also known as duck viral enteritis, is caused by duck plague virus, also known as duck enteritis virus (DEV), and is an acute, contact, septic infectious disease of ducks, geese and other birds of the order Anseriformes , characterized by vascular injury, gastrointestinal hemorrhage and necrosis, lymphoid organ damage, and degenerative changes in parenchymal organs. Clinically, in addition to acute cases, DEV can also form latent infections in the trigeminal nerve and lymphoid tissues [1] . Under natural conditions, the disease mainly occurs in ducks, and ducks of different ages, sexes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N15/38C12N7/00C12N7/01A61K39/245A61P31/20C12R1/93
Inventor 陈化兰柳金雄步志高姜永萍
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap