Rice rhizoctonia solani effector gene AG1IA06910 and application thereof
A technology of AG1IA06910 and Rhizoctonia solani, applied in the field of genetic engineering, can solve problems such as unclear action sites of Rlm resistance genes, and achieve the effect of controlling the occurrence of sheath blight
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1: Cloning of predicted effector genes
[0038] The AG1IA strain was isolated and purified from rice sheath blight diseased plants by the Rice Institute of Sichuan Agricultural University. It is a common fungal strain on rice plants and is widely distributed in rice cultivation areas. (AG1IA strain has been published in Sichuan Agricultural University, master's thesis, analysis of different proteins induced by Rhizoctonia solani AG1IA in maize, author Li Yun)
[0039] Under the ultra-clean workbench, use tweezers to pick a small amount of AG1IA mycelium, put it into 50ml PDA medium, mash the mycelium, culture at 28°C, 200r / m for two days, and collect the mycelium by filtering with four layers of gauze. Total RNA was extracted by triturating with liquid nitrogen. Using oligodT as a primer, cDNA was obtained by reverse transcription. Primers were designed according to the predicted sequence as follows:
[0040] 5'ATGTGCAGCGCACTTGTGTCCAGACCATGTGATA AGATCTGG3'
...
Embodiment 2
[0042] Embodiment 2: Construction, transformation and expression of effector gene prokaryotic expression vector
[0043] The electrophoresis detection of the target gene obtained by PCR has no bands, and the target gene can be connected to the expression vector pEASY-E1 according to the instructions of TransGen Biotech Peasy-E1kit. The sequenced gene AG1IA06910 is exactly the same as the predicted sequence, and the base sequence is as shown in SEQ ID NO .1 shown. The transformation conditions are the same as the conventional E. coli transformation conditions. Positive transformants are picked, cultured at 37°C until the OD value is 0.6, then transferred to 28°C, induced by IPTG1mM for 7 to 11 hours, and the effector protein is expressed. SDS-PAGE detection picture of expressed protein image 3 .
Embodiment 3
[0044] Embodiment 3: Pathogenicity detection of expressed protein
[0045] Collect the cells expressing AG1IA06910 and ultrasonically crush to obtain crude protein. Be careful not to denature the protein during the crushing process (the crushing time is preferably 5 seconds, the power should not exceed 200W, and the sample is always kept in an ice bath during the crushing process). Select rice leaves at the three-leaf stage cultivated in a greenhouse with consistent growth, and place them in a sterilized petri dish with two layers of filter paper built in to keep the filter paper moist to keep the leaves moist. Use a sterilized toothpick to make a small hole in the center of the rice leaf, cover the small hole with three layers of sterilized 0.5cm×0.5cm filter paper, and inoculate 50 microliters of crude protein. The infected leaves were placed in a light incubator at 28 degrees Celsius, with light for 12 hours, dark for 12 hours, and RH (disease index) 80%. Observe the disea...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap