Receptor-like protein kinase gene, and expression vector and application thereof
A technology of receptor protein and expression vector, applied in the field of genetic engineering, can solve problems such as loss of resistance to powdery mildew and rapid change of pathogenic bacteria species
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Cloning of a receptor-like protein kinase gene induced by powdery mildew in wheat IGVI465 containing Pm6 in embodiment 1
[0023] The fine mapping of Pm6 has been completed in the early stage of this study. On the basis of fine mapping, a comparative genomics study was carried out on the area where Pm6 is located, Brachypodium and rice, and it was found that wheat, rice, and Brachypodium had good collinearity in the area where Pm6 was located (Bi Qin, Aizhong Cao et al. al. Collinearity-based marker mimng for the fine mapping of Pm6, a powdery mildew resistance gene in wheat. Theor Appl Genet. 2011, 123: 201-218). In this study, a leucine-rich receptor-like protein kinase gene (LRR-RLK) was predicted in Brachypodium and rice genome sequences that were colinear with the Pm6 region, and it was also predicted to exist in the Pm6 region of wheat IGVI465 A gene homologous to receptor-like protein kinase gene in model species, this gene may be a candidate gene of Pm6 gene. ...
Embodiment 2
[0029] The construction of embodiment 2 TaLRR-RLK2 gene transient expression vector
[0030] With the TaLRR-RLK2 gene cDNA cloned in IGVI465 induced by powdery mildew as a template, the primer pair RLK-ATG-BamHI-F (CGGGATCCATGGGGCGGAGGAGGCA, SEQ ID NO.11) and RLK-TGA-KpnI-R (GGGGTACCTCAACGGCCTTCGTCCA, SEQ ID NO.12) Carry out PCR amplification, and recover the amplified fragment. The amplified product was double digested with BamHI and KpnI, and the digested product was inserted into the vector pBI220 ((Jefferson RA, Kavanagh TA, Bevan MW.GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987, 6: 3901-3907.)), put TaLRR-RLK2 at the multiple cloning site behind the 35S promoter. Thus, the target gene TaLRR-RLK2 was cloned to the downstream of the strong promoter 35S to obtain the expression vector pBI220: Ta-LRR-RLK2 ( figure 1 ). It was verified by sequencing that the vector was constructed successfully.
Embodiment 3
[0031] Example 3 Transfer of TaLRR-RLK2 gene into wheat leaves by transient expression method
[0032] The transient expression method is a reliable and rapid method for identifying gene functions (Schweizer, Pokorny et al. A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat Molecular Plant-Microbe Interactions. 1999, 12: 647-654.) . In this study, the transient expression method was used to wrap the plasmid DNA on the outer layer of metal particles, and the metal particles and genes were bombarded into the epidermal cells of wheat leaves with the help of a gene gun. The powdery mildew haustoria index of RLK2 cells, to clarify whether the target gene has powdery mildew resistance function.
[0033] The procedure for encapsulating carrier DNA and metal particles is as follows:
[0034] Preparation of tungsten powder: Weigh 30mg of tungsten powder into a 1.5ml eppendorf tube, add 1ml of 70% alcohol, vortex for 3-5min and then let stand for ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com