Construction method for streptomycete expression plasmids and production method for keratinase

A technology of expression plasmid and construction method, which is applied in the field of construction of Streptomyces expression plasmid, and can solve the problems of lack of advantages in induced expression, inability of expression amount to meet industrial production requirements, and low expression level.

Inactive Publication Date: 2012-07-04
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although sfp2 was successfully expressed in Escherichia coli and Bacillus subtilis, the expression level was very low, so Li Jiang et al. used the Pichia pastoris expression system to induce the expression of sfp2 gene
The yield and activity of this protein expressed by Pichia pastoris are higher than those expressed in Escherichia coli and Bacillus subtilis, but the expression level cannot meet the requirements of industrial production, and the expressed keratinase also has glycosylation problems, which affect the activity of the enzyme and induce Expression does not have advantages in industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for streptomycete expression plasmids and production method for keratinase
  • Construction method for streptomycete expression plasmids and production method for keratinase
  • Construction method for streptomycete expression plasmids and production method for keratinase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, keratinase gene ( sfks ) of the separation

[0036] According to Streptomyces flexneri k-11 published online ( Streptomyces fradiae var. k-11) Keratinase gene sfp 2 (EMBL accession number AJ784940) sequence, designed primers

[0037] sfks PF: 5'-AACATATGCGCTTCACCCCCCG-3' (SEQ ID NO: 3)

[0038] sfks PR: 5'-GGGATCCGTCAGATGATGCTGACG-3' (SEQ ID NO: 4).

[0039] Amplified by this primer sfks Genes, including keratinase maturation enzyme gene (encoding 191aa), an N-terminal leader peptide (encoding 78aa) and Streptomyces exocrine signal peptide (encoding 38aa).

[0040] The reaction system is: 10×KOD-plus buffer 5μl, dNTP mix (2.5mmol / L) 5μl, MgSO 4 (25μM) 1.5μl, 50%DMSO 3μl, template DNA 1μl, Primer R (20μM) 1μl, Primer F (20μM) 1μl, KOD-plus (1U / μl) 1μl, ddH 2 O 31.5 μl. The reaction conditions were: denaturation at 95°C for 5min, 30s at 95°C, 30s at 65°C, extension at 72°C for 1min30s, a total of 30 cycles, and 5min at 72°C. Th...

Embodiment 2

[0041] Embodiment 2, expression plasmid construction

[0042] In the present invention, pSP72 is double-digested with XbaI and EcoRI, and a 1700bp fragment is recovered. Similarly, pHZ1358 is digested with XbaI and EcoRI to obtain a 5424bp fragment. The two fragments are connected by PCR to construct plasmid pJTU4880, and then the cloned sfks The gene is inserted into the synthetic Xi ​​promoter-SD (ribosome binding site)-amyA2 terminator fragment to construct the expression box structure, and the expression box structure schematic diagram is as follows figure 2 As shown, its corresponding expression box gene sequence is shown in SEQ ID NO:5:

[0043] tctagagcatgcgcccaccggcgatcaggtcgtcgacgagcgcggagacggtggcccgggtgagcccggtgacggcggcaactcccgcgcgggagagccgatctgtgctgtttgccacggtatgcagcaccagcgcgagattatgggctcgcacgctcgactgtcggacgggggcactggaacgagaagtcaggcgagccgtcacgcccttgacaatgccacatcctgagcaaataattcaaccactaaacaaatcaaccgcgtttcccggaggatgcagtgaacctcaagcgcttcaccccccgcggcggactcgcgagagg...

Embodiment 3

[0045] Embodiment 3, heterologous expression of keratinase

[0046] Transformation of the target plasmid with oriT into Escherichia coli ET12567 (pUZ8002) (Tao Weixin, Wu Jing, Deng Zixin, Tao Meifeng. Cloning of bldA in Streptomyces avermitilis NLLL8165 and its effect on morphological differentiation and abamectin synthesis. Microbial After the competent cells in Acta Sinica (2007) 47 (1): 34-38), the transformed cells were cultured overnight, and the culture was inoculated in fresh LB with an inoculum of 1:20, and cultured at 37°C for 3-4 hours; collected sky blue Streptomyces spores were washed once with sterile water, centrifuged at 4500rpm for 3min, and the supernatant was washed dry, then washed once with 0.05 mol / L TES (pH8.0), heat-shocked at 50°C for 10min, cooled in water and then added with 750μL spore germination solution , incubate at 37°C for 2 hours, centrifuge at 4500rpm for 10min, wash the pellet twice with LB to remove antibiotics, and finally suspend i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a construction method for streptomycete expression plasmids and a production method for keratinase. The construction method for streptomycete expression plasmids includes the following steps: a promoter Xi of actinoplanes missouriensis xylose isomerase and a terminator of streptomycete avermitilis amylase are sleeved, and the promoter-shine-dalgarno (SD) sequence comes from 90 to 269bp of an actinoplanes missouriensis xylose isomerase gene; a cloned src family kinases (sfks) gene is inserted in a construction expression frame structure of a synthetic Xi promoter-SD-amyA2 terminator fragment, and then a conventional method is used for constructing the streptomycete expression plasmids. The production method for keratinase includes: leading the streptomycete expression plasmids into an expression host of streptomycete lividans TK24 through conjugal transfer, performing recombinant expression and generating the keratinase. Specific activity of a crude enzyme solution is 1700 U / mg after expression of the expression plasmids in the streptomycete lividans TK24 and is improved by 50 times compared with specific activity of starting strain streptomycete fradiae varieties S-221, and yield of the keratinase is much higher than starting strains after the expression.

Description

technical field [0001] The invention relates to a construction method of streptomyces expression plasmid and a production method of keratinase. Background technique [0002] Keratinases (Keratinases, EC 3.4.21 / 24 / 99.11) are proteolytic enzymes that can specifically degrade natural keratin. Keratin protein has a stable chemical structure and is insoluble in water. Its chains are composed of α-helical or β-sheet structures, and form a very stable and highly cross-linked three-dimensional structure through disulfide bonds, hydrogen bonds and other cross-linking bonds. Under normal conditions, keratin is insoluble, and even animal-derived proteases such as caseinase and trypsin cannot degrade keratin, but can be degraded by keratinase. [0003] Keratinase can be used in the feed industry. Poultry feather protein content is as high as 85%-90%, containing 13 main amino acids, except for 4 kinds of methionine and lysine, the content of other amino acids is higher than that of fis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/66C12N9/52
Inventor黄曦李俊霞王钱福殷俊李明珠邓子新张日俊涂国全
OwnerSHANGHAI JIAO TONG UNIV