Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2
A technology encoding gene and powdery mildew, applied in genetic engineering, plant genetic improvement, virus/phage, etc., can solve the problems of fast mutation speed and loss of resistance of disease resistance genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1, the acquisition of TaWRKY2
[0025] 1. Candidate EST and electronic extension of gene full-length cDNA
[0026] Using barley HvWRKY1 as the seed sequence, search the wheat EST database ( http: / / compbio.dfci.harvard.edu / tgi / cgi-bin / tgi ) in EST sequences, save highly homologous EST sequences, assemble the searched sequences into contigs (contig), and design specific primers outside the predicted open reading frame (Open reading frame, ORF); primers The sequence is as follows:
[0027] TaWRKY2: F2 5'>ATGGAGGAGCAGTGGATGAT>3' (SEQ ID NO: 3)
[0028] R2 5'>TCAAGCAACAGGGATCCGAC>3' (SEQ ID NO: 4)
[0029] 2. Cloning of cDNA of wheat TaWRKY2 gene
[0030] Select 40 seeds each of Yumai 66 (high resistance to powdery mildew) and Jing 411 (high susceptibility to powdery mildew) of the same size, and sow them in seedling pots until the first leaf is fully unfolded (about a week). Wheat materials were inoculated at high density with wheat powdery mildew ...
Embodiment 2
[0032] Example 2, Research on Molecular Characteristics and Action Mechanism of Wheat TaWRKY2
[0033] One of the characteristics of transcription factors is that they localize in the nucleus and perform their transcriptional regulatory functions in the nucleus. To this end, the subcellular localization of wheat TaWRKY2 protein was studied in wheat leaf cells by gene gun-mediated method. The results showed that, like barley HvWRKY2, wheat TaWRKY2 was also localized in the nucleus ( figure 1 ). figure 1 Among them, CFP (cyan fluorescent protein), CFP-HvWRKY2 (CFP is at the N-terminal of HvWRKY2, TaWRKY2-YFP (yellow fluorescent protein is at the C-terminal of TaWRKY2), Overlay overlaps.
Embodiment 3
[0034] Example 3, Functional Research of TaWRKY2 in Barley and Wheat Resistance to Powdery Mildew
[0035] 1. The function of TaWRKY2 in resistance to powdery mildew in barley
[0036] (1) Effect of TaWRKY2 on race-specific resistance in barley
[0037] The vector pGY-1 has been disclosed in the document "Patrick Schweizer et al, A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat. MPMI, 1999, 12: 647-654", and the public can download it from Genetics and Development of the Chinese Academy of Sciences Acquired by the Institute of Biology.
[0038] The vector p35S-GUS has been disclosed in the document "Patrick Schweizer et al, A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat. MPMI, 1999, 12: 647-654", and the public can download it from the Chinese Academy of Sciences Genetics and Development Acquired by the Institute of Biology.
[0039] Barley variety P01 (containing Mla1) has been disclosed in t...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap