Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2

A technology encoding gene and powdery mildew, applied in genetic engineering, plant genetic improvement, virus/phage, etc., can solve the problems of fast mutation speed and loss of resistance of disease resistance genes

Inactive Publication Date: 2012-08-29
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because wheat powdery mildew has a large population, a wide range of adaptation, many physiol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2
  • Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2
  • Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1, the acquisition of TaWRKY2

[0025] 1. Candidate EST and electronic extension of gene full-length cDNA

[0026] Using barley HvWRKY1 as the seed sequence, search the wheat EST database ( http: / / compbio.dfci.harvard.edu / tgi / cgi-bin / tgi ) in EST sequences, save highly homologous EST sequences, assemble the searched sequences into contigs (contig), and design specific primers outside the predicted open reading frame (Open reading frame, ORF); primers The sequence is as follows:

[0027] TaWRKY2: F2 5'>ATGGAGGAGCAGTGGATGAT>3' (SEQ ID NO: 3)

[0028] R2 5'>TCAAGCAACAGGGATCCGAC>3' (SEQ ID NO: 4)

[0029] 2. Cloning of cDNA of wheat TaWRKY2 gene

[0030] Select 40 seeds each of Yumai 66 (high resistance to powdery mildew) and Jing 411 (high susceptibility to powdery mildew) of the same size, and sow them in seedling pots until the first leaf is fully unfolded (about a week). Wheat materials were inoculated at high density with wheat powdery mildew ...

Embodiment 2

[0032] Example 2, Research on Molecular Characteristics and Action Mechanism of Wheat TaWRKY2

[0033] One of the characteristics of transcription factors is that they localize in the nucleus and perform their transcriptional regulatory functions in the nucleus. To this end, the subcellular localization of wheat TaWRKY2 protein was studied in wheat leaf cells by gene gun-mediated method. The results showed that, like barley HvWRKY2, wheat TaWRKY2 was also localized in the nucleus ( figure 1 ). figure 1 Among them, CFP (cyan fluorescent protein), CFP-HvWRKY2 (CFP is at the N-terminal of HvWRKY2, TaWRKY2-YFP (yellow fluorescent protein is at the C-terminal of TaWRKY2), Overlay overlaps.

Embodiment 3

[0034] Example 3, Functional Research of TaWRKY2 in Barley and Wheat Resistance to Powdery Mildew

[0035] 1. The function of TaWRKY2 in resistance to powdery mildew in barley

[0036] (1) Effect of TaWRKY2 on race-specific resistance in barley

[0037] The vector pGY-1 has been disclosed in the document "Patrick Schweizer et al, A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat. MPMI, 1999, 12: 647-654", and the public can download it from Genetics and Development of the Chinese Academy of Sciences Acquired by the Institute of Biology.

[0038] The vector p35S-GUS has been disclosed in the document "Patrick Schweizer et al, A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat. MPMI, 1999, 12: 647-654", and the public can download it from the Chinese Academy of Sciences Genetics and Development Acquired by the Institute of Biology.

[0039] Barley variety P01 (containing Mla1) has been disclosed in t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses a protein TaWRKY2 related to powdery mildew resistance and a coding gene of the protein TaWRKY2. The protein is the following protein in a) or b): a) the protein is made up of an amino acid sequence indicated in SEQ ID NO: 1; and b) the protein derives from that in a) in such a way that the amino acid sequence indicated in SEQ ID NO: 1 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues, and is related to powdery mildew resistance. Experiments prove that the gene disclosed by the invention plays a role in negative regulation of the powdery mildew resistance of wheat or barley; and the gene has a wide application prospect in the aspect of wheat breeding and is significant in the aspect of guaranteeing high and stable yield of wheat.

Description

technical field [0001] The invention relates to a protein TaWRKY2 related to powdery mildew resistance and its coding gene. Background technique [0002] Wheat powdery mildew (Powdery mildew) is a fungal disease caused by the obligate parasitic fungus Powdery mildew Bgt (Blumeria graminis f sp. tritici). It is a worldwide distribution disease and seriously affects the world's wheat production. In recent years, due to the increase of crop planting density, the increase of nitrogen fertilizer application, and the single planting of crops, the damage caused by wheat powdery mildew has become increasingly serious. After the wheat is damaged, it can lead to early withering of leaves, reduced photosynthesis, enhanced respiration, reduced number of tillers, reduced ear formation rate, and reduced dry grain weight. Generally, the yield can be reduced by 5% to 10%, and the yield of severely diseased fields can be reduced by more than 20%. Because wheat powdery mildew has a large pop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/11C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N7/01A01H5/00
Inventor 沈前华韩新运王秋韫刘敏
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap