Preparation method of plasmodium vivax aldolase protein monoclonal antibody

A protozoan aldolase protein and monoclonal antibody technology, which is applied in the fields of genetic engineering and immunology, can solve the problems of low detection efficiency, time-consuming and laborious, and hinder popularization, and achieve the effect of mass production

Active Publication Date: 2012-09-26
HANGZHOU ALLTEST BIOTECH
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional thick blood film microscopy is time-consuming and laborious, and the detection efficiency is low. In recent years, nucleic acid detection methods have been applied in the diagnosis of malaria. Although this method has high specificity and sensitivity, it has high technical requirements and requires skilled personnel. operator, hindering further adoption of the method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026]Example 1 Preparation of Plasmodium vivax antigen

[0027] 1.1 Selection of dominant epitopes of Plasmodium vivax

[0028] Taking Plasmodium vivax aldolase protein as the target antigen, analyzing the hydrophilicity and antigenicity of its amino acid sequence, and selecting three dominant epitopes A, B, and C.

[0029] The nucleic acid sequence of epitope A is: GAGGGAATCATTCCAGGAATTAAAGTTGAC AAAGGATTGGTTACCATCCCATGCACTGATGATGAGAAGTCCACCCAGGGATTAGATGGTCTAGCTGAGAGGTGTAAAGAATATTACAAAGCTGGTGCAAGGTTTGCAAAATGGAGAGCT; its amino acid sequence is: GluGlyIleIleProGlyIleLysValAsp

[0030] LysGlyLeuValThrIleProCysThrAspAspGluLysSerThrGlnGlyLeuAspGlyLeuAlaGluArgCysLysGluTyrTyrLysAlaGlyAlaArgPheAlaLysTrpArgAla.

[0031] 抗原表位B的核酸序列为:ATTGGTTTTCTCACAGTGAGAACTTTAAGTA GGACAGTGCCACCATCCTTACCAGGAGTTGTATTCTTATCTGGAGGTCAATCTGAAGAAGAAGCATCTGTCAATTTGAATTCCATCAATGCGTTAGGCCCACACCCATGGGCGTTGACC;其氨基酸序列为:IleGlyPheLeuThrValArgThrLeuSerArg ThrValProProSerLeuProGlyValValPheLeuSerGlyGlyGlnSerGluGluGluAl...

Embodiment 2

[0044] Example 2 Screening of hybridoma cell lines directed against Plasmodium vivax recombinant proteins

[0045] 2.1 Immunization of mice with Plasmodium vivax recombinant protein

[0046] 6-8 weeks old female BALB / C mice (purchased from Shanghai Slack Experimental Animal Co., Ltd.) were immunized with recombinant protein emulsified in Freund's complete adjuvant at multiple points for the first immunization, 100ug / mouse, and the subsequent immunization was performed every two weeks Rats were intraperitoneally injected with recombinant protein fully emulsified in incomplete Freund's adjuvant, 100ug / rat, and blood was collected from the tail vein after the fifth immunization to determine the serum titer. Mice with better serum titer were selected for booster immunization, and the recombinant protein was injected into the spleen, 50ug / mouse.

[0047] 2.2 Cell Fusion

[0048] 2.2.1 Preparation of feeder cells

[0049] Mice were sacrificed by removing their eyeballs, soaking...

Embodiment 3

[0061] Example 3 Mass preparation and purification of monoclonal antibodies

[0062] 3.1 Mass production of monoclonal antibodies

[0063] Select healthy F1 mice of 8-10 weeks old, and inject 0.5 mL of liquid paraffin into each mouse about one week before hybridoma cell inoculation. Each cell line was injected into 5 mice, and each mouse was injected intraperitoneally with about 1×10 6 Hybridoma cells, mice began to produce ascites 7 to 10 days after inoculation. During this period, the health status of the mice and signs of ascites were closely observed, and the ascites of the mice was introduced into the test tube with a syringe. Repeat this several times, and the mice were on the verge of death. Before that, the ascites was removed and the mice were sacrificed.

[0064] 3.2 Purification of monoclonal antibodies

[0065] 3.2.1 50% ammonium sulfate precipitation

[0066] Dilute with PB solution 4 times the volume of ascites, slowly add saturated ammonium sulfate (pH 7.0) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation of method of a plasmodium vivax aldolase protein monoclonal antibody. According to the antibody, aldolase protein is specifically used as targeting antigen; three dominant antigen epitopes A, B and C are selected and connected by flexible segments so as to form a recombinant D; enzyme cutting sites of BamHI and XhoI restriction enzymes are added on the upper course and the lower course of the recombinant, respectively; then the product after double enzyme cutting processes is inserted into PET-28a (+) carrier so as to structure a recombined protein D expression carrier; the recombined protein D is expressed by escherichia coli BL21; a Balb / c mouse is immunized; spleen cells of the mouse are taken and fused with sp2 / 0 myeloma cells; and finally ten hybridoma cell lines capable of stably secreting aldolase protein monoclonal antibody are obtained after filtering. The monoclonal antibody obtained by the method provided by the invention is capable of specifically identifying tertian plasmodium aldolase protein so that the monoclonal antibody is beneficial for the specific detection of tertian plasmodium infection; in addition, the specificity is high, the response is sensitive, and the experiment cost is low, so that the antibody is suitable for the high-pass rapid detection.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and immunology, in particular to a preparation method of a Plasmodium vivax aldolase protein monoclonal antibody, and the obtained monoclonal antibody can be applied to the detection of Plasmodium vivax by enzyme-linked immunoassay, and can also be used as Part of the rapid diagnostic kit for Plasmodium vivax. Background technique [0002] Malaria is widely prevalent in tropical and subtropical developing countries and is a parasitic disease transmitted by mosquitoes that seriously endangers human health. The harm of Plasmodium vivax to humans is second only to Plasmodium falciparum. It is estimated that the number of people infected by Plasmodium vivax in the world is as high as 2.6 billion, and about 80 million to 300 million people suffer acute attacks due to infection by Plasmodium vivax every year. In my country, the malaria epidemic is on the rise after 2000. It is estimated tha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/40
CPCY02A50/30
Inventor陈东张海燕庞醒华
OwnerHANGZHOU ALLTEST BIOTECH