Preparation method of plasmodium vivax aldolase protein monoclonal antibody
A protozoan aldolase protein and monoclonal antibody technology, which is applied in the fields of genetic engineering and immunology, can solve the problems of low detection efficiency, time-consuming and laborious, and hinder popularization, and achieve the effect of mass production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0026]Example 1 Preparation of Plasmodium vivax antigen
[0027] 1.1 Selection of dominant epitopes of Plasmodium vivax
[0028] Taking Plasmodium vivax aldolase protein as the target antigen, analyzing the hydrophilicity and antigenicity of its amino acid sequence, and selecting three dominant epitopes A, B, and C.
[0029] The nucleic acid sequence of epitope A is: GAGGGAATCATTCCAGGAATTAAAGTTGAC AAAGGATTGGTTACCATCCCATGCACTGATGATGAGAAGTCCACCCAGGGATTAGATGGTCTAGCTGAGAGGTGTAAAGAATATTACAAAGCTGGTGCAAGGTTTGCAAAATGGAGAGCT; its amino acid sequence is: GluGlyIleIleProGlyIleLysValAsp
[0030] LysGlyLeuValThrIleProCysThrAspAspGluLysSerThrGlnGlyLeuAspGlyLeuAlaGluArgCysLysGluTyrTyrLysAlaGlyAlaArgPheAlaLysTrpArgAla.
[0031] 抗原表位B的核酸序列为:ATTGGTTTTCTCACAGTGAGAACTTTAAGTA GGACAGTGCCACCATCCTTACCAGGAGTTGTATTCTTATCTGGAGGTCAATCTGAAGAAGAAGCATCTGTCAATTTGAATTCCATCAATGCGTTAGGCCCACACCCATGGGCGTTGACC;其氨基酸序列为:IleGlyPheLeuThrValArgThrLeuSerArg ThrValProProSerLeuProGlyValValPheLeuSerGlyGlyGlnSerGluGluGluAl...
Embodiment 2
[0044] Example 2 Screening of hybridoma cell lines directed against Plasmodium vivax recombinant proteins
[0045] 2.1 Immunization of mice with Plasmodium vivax recombinant protein
[0046] 6-8 weeks old female BALB / C mice (purchased from Shanghai Slack Experimental Animal Co., Ltd.) were immunized with recombinant protein emulsified in Freund's complete adjuvant at multiple points for the first immunization, 100ug / mouse, and the subsequent immunization was performed every two weeks Rats were intraperitoneally injected with recombinant protein fully emulsified in incomplete Freund's adjuvant, 100ug / rat, and blood was collected from the tail vein after the fifth immunization to determine the serum titer. Mice with better serum titer were selected for booster immunization, and the recombinant protein was injected into the spleen, 50ug / mouse.
[0047] 2.2 Cell Fusion
[0048] 2.2.1 Preparation of feeder cells
[0049] Mice were sacrificed by removing their eyeballs, soaking...
Embodiment 3
[0061] Example 3 Mass preparation and purification of monoclonal antibodies
[0062] 3.1 Mass production of monoclonal antibodies
[0063] Select healthy F1 mice of 8-10 weeks old, and inject 0.5 mL of liquid paraffin into each mouse about one week before hybridoma cell inoculation. Each cell line was injected into 5 mice, and each mouse was injected intraperitoneally with about 1×10 6 Hybridoma cells, mice began to produce ascites 7 to 10 days after inoculation. During this period, the health status of the mice and signs of ascites were closely observed, and the ascites of the mice was introduced into the test tube with a syringe. Repeat this several times, and the mice were on the verge of death. Before that, the ascites was removed and the mice were sacrificed.
[0064] 3.2 Purification of monoclonal antibodies
[0065] 3.2.1 50% ammonium sulfate precipitation
[0066] Dilute with PB solution 4 times the volume of ascites, slowly add saturated ammonium sulfate (pH 7.0) ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com