Application of osa-MIR167a gene for regulating and controlling plant type of paddy rice

A rice plant type, gene regulation technology, applied in the field of plant genetic engineering

Inactive Publication Date: 2012-10-10
HUAZHONG AGRI UNIV
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In rice, only reports have shown that there is a regulatory pathway of miRNA167-ARF-GH3 (Yang et al., Evidence of an auxin signal pathway, microRNA 167-ARF8-GH3, and its response to exogenous auxin in cultured rice cells. Nucleic Acids Res , 2006, 34:1892-1899), there is no report on the regulation of plant type by osa-MIR167a gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of osa-MIR167a gene for regulating and controlling plant type of paddy rice
  • Application of osa-MIR167a gene for regulating and controlling plant type of paddy rice
  • Application of osa-MIR167a gene for regulating and controlling plant type of paddy rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Analysis of osa-MIR167 gene family members

[0032] According to miRBase (Release 16) (http: / / www.mirbase.org / cgi-bin / mirna_summary.pl?org=osa) data, the osa-MIR167 gene family has a total of 10 members, which are named osa-MIR167a to osa-MIR167j. It has been confirmed that osa-MIR167a and osa-MIR167h form the same cluster in tandem, while other genes are scattered in individual chromosomes. The stem-loop structure length and sequence of each member of the osa-MIR167 gene family are different, but there are only two core osa-miR167 sequences formed by splicing, as shown in SEQ ID NO:3 and SEQ ID NO:4. The core sequence of osa-MIR167a to osa-MIR167c is SEQ ID NO:3, and the core sequence of osa-MIR167d to osa-MIR167j is SEQ ID NO:4. The two core sequences only have a base conversion at the 3' last position, and studies have confirmed that one or two base conversions in the core region will not cause functional differences.

[0033] Table 1 Analysis of members...

Embodiment 2

[0035] Expression analysis of embodiment 2osa-MIR167a gene

[0036] The rice variety Zhonghua 11 was planted in a field at a density of 20 cm×25 cm (length×width). 30 days after transplanting, it is in the vigorous tillering stage, and the RNA of the six tissue parts of root (R), stem (S), leaf (L), leaf sheath (SH), lateral bud (TB) and young ear (P) is extracted The sample was detected by miRNA stem-loop RT-PCR (Chen et al., Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res, 2005, 33: e179) to detect the expression level of osa-MIR167a gene, set 3 One biological repeat and two technical repeats. The primers used are: MIR167a ST-RT primer:

[0037] 5'GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGATC3', MIR167a Forward:

[0038] 5'CTAATGAAGCTGCCAGCATG3', ST-R: 5'GTGCAGGGTCCGAGGT3'. With U6 as the internal reference, the corresponding primers are

[0039] U6-L: 3'TACAGATAAGATTAGCATGGCCCC5', U6-R: 3'GGACCATTTCTCGATTTGTACGTG5'. For reverse transc...

Embodiment 3

[0040] Example 3 Overexpression of osa-MIR167a gene to verify its function

[0041] 1. Construction of osa-MIR167a gene overexpression vector

[0042]The vector used is pU1301 constructed in our laboratory. pU1301 is a commonly used plant genetic transformation vector pCAMBIA1301 in the world (Sun et al., 2004, Xa26, a gene conferring resistance to Xanthomonas oryzae pv.oryzae in rice, encoding a LRRreceptor kinase-like protein. Plant Journal.37: 517-527) An Agrobacterium-mediated genetic transformation vector carrying a maize ubiquitin promoter with constitutive and overexpression characteristics based on transformation (see Figure 7 ). The pCAMBIA1301 vector was kindly provided by the Australian CAMBIA Laboratory (Center for the Application of Molecular Biology to International Agriculture). Using the PCR method, the osa-MIR167a stem-loop structure sequence was directly amplified from the rice genome. In order to ensure that the stem-loop structure can be correctly trans...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant genetic engineering and specifically relates to an application of an osa-MIR167a gene for regulating and controlling plant type of paddy rice. The osa-MIR167a gene has several homologous genes in paddy rice genome and belongs to a same gene family MIR167 as an arabidopsis thaliana ath-MIR167 gene. The osa-MIR167a gene has a function of regulating and controlling the plant type of paddy rice and the nucleotide sequence thereof is shown in the sequence table SEQ ID NO:1 while the core sequence formed by transcription and splicing is shown in the sequence table SEQ ID NO:3. An ideal plant type and increased yield are achieved by changing the expression models of the osa-MIR167a gene or other members in the osa-MIR167a gene family through gene engineering and regulating and controlling the tillering angle, the height and the effective tillering number of the plant. The invention discloses the application of the osa-MIR167a gene for regulating and controlling the plant type of paddy rice.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to a gene osa-MIR167a regulating rice plant type, and also relates to the application of the gene in transgenic rice and transgenic rice seeds. The invention proves the function of the gene by overexpressing the osa-MIR167a gene, causing normal rice to have plant type changes such as increased tiller angle, dwarfing, and reduced effective tiller number. It also involves regulating the rice plant type by changing the expression pattern of the gene or its homologous gene, thereby increasing the yield of rice. Background technique [0002] As an important food crop, rice is the staple food for more than one-third of the world's people. At the same time, rice is regarded as a model plant because of its small genome, fine genetic and physical maps, relatively easy transgenic technology, and collinearity with other grass crops. With the completion of genome sequencing...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00
Inventor吴昌银韦懿熊立仲
OwnerHUAZHONG AGRI UNIV