Application of osa-MIR167a gene for regulating and controlling plant type of paddy rice
A rice plant type, gene regulation technology, applied in the field of plant genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Analysis of osa-MIR167 gene family members
[0032] According to miRBase (Release 16) (http: / / www.mirbase.org / cgi-bin / mirna_summary.pl?org=osa) data, the osa-MIR167 gene family has a total of 10 members, which are named osa-MIR167a to osa-MIR167j. It has been confirmed that osa-MIR167a and osa-MIR167h form the same cluster in tandem, while other genes are scattered in individual chromosomes. The stem-loop structure length and sequence of each member of the osa-MIR167 gene family are different, but there are only two core osa-miR167 sequences formed by splicing, as shown in SEQ ID NO:3 and SEQ ID NO:4. The core sequence of osa-MIR167a to osa-MIR167c is SEQ ID NO:3, and the core sequence of osa-MIR167d to osa-MIR167j is SEQ ID NO:4. The two core sequences only have a base conversion at the 3' last position, and studies have confirmed that one or two base conversions in the core region will not cause functional differences.
[0033] Table 1 Analysis of members...
Embodiment 2
[0035] Expression analysis of embodiment 2osa-MIR167a gene
[0036] The rice variety Zhonghua 11 was planted in a field at a density of 20 cm×25 cm (length×width). 30 days after transplanting, it is in the vigorous tillering stage, and the RNA of the six tissue parts of root (R), stem (S), leaf (L), leaf sheath (SH), lateral bud (TB) and young ear (P) is extracted The sample was detected by miRNA stem-loop RT-PCR (Chen et al., Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res, 2005, 33: e179) to detect the expression level of osa-MIR167a gene, set 3 One biological repeat and two technical repeats. The primers used are: MIR167a ST-RT primer:
[0037] 5'GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGATC3', MIR167a Forward:
[0038] 5'CTAATGAAGCTGCCAGCATG3', ST-R: 5'GTGCAGGGTCCGAGGT3'. With U6 as the internal reference, the corresponding primers are
[0039] U6-L: 3'TACAGATAAGATTAGCATGGCCCC5', U6-R: 3'GGACCATTTCTCGATTTGTACGTG5'. For reverse transc...
Embodiment 3
[0040] Example 3 Overexpression of osa-MIR167a gene to verify its function
[0041] 1. Construction of osa-MIR167a gene overexpression vector
[0042]The vector used is pU1301 constructed in our laboratory. pU1301 is a commonly used plant genetic transformation vector pCAMBIA1301 in the world (Sun et al., 2004, Xa26, a gene conferring resistance to Xanthomonas oryzae pv.oryzae in rice, encoding a LRRreceptor kinase-like protein. Plant Journal.37: 517-527) An Agrobacterium-mediated genetic transformation vector carrying a maize ubiquitin promoter with constitutive and overexpression characteristics based on transformation (see Figure 7 ). The pCAMBIA1301 vector was kindly provided by the Australian CAMBIA Laboratory (Center for the Application of Molecular Biology to International Agriculture). Using the PCR method, the osa-MIR167a stem-loop structure sequence was directly amplified from the rice genome. In order to ensure that the stem-loop structure can be correctly trans...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 