Haliotis gigantea discus hemocyanin I and II type subunit genes and cloning method

A protein and abalone blood technology, applied in chemical instruments and methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems of large shellfish hemocyanin gene and high cost, and achieve the effect of reducing medical costs.

CN102719440BInactive Publication Date: 2013-07-03SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Publication Date
2013-07-03
Estimated Expiration
Not applicable · inactive patent

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses Haliotis gigantea discus hemocyanin I and II type subunit genes and a cloning method. The Haliotis gigantea discus hemocyanin I type subunit gene and II type subunit gene are favorable to developing gene function and correlated application research of in-vivo important immunization molecules of hemocyanin and other Haliotis gigantea discus, and has important significance in preventing and treating diseases of ormer and other economic shellfish; and the Haliotis gigantea discus hemocyanin I type subunit gene and II type subunit gene resources are further applied to immunization medical field, and the medical treatment cost is lowered.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to a variegated abalone hemocyanin I subunit gene and a type II subunit gene, and also relates to a method for cloning the variegated abalone hemocyanin I subunit gene and the type II subunit gene. Background technique

[0002] Hemocyanin is one of the three major respiratory proteins in the animal kingdom. It mainly exists in the blood of lower animals such as arthropods and molluscs. Its active center combines two Cu + Ions, capable of reversibly binding oxygen. When combined with oxygen, colorless Cu + Cu that turns blue 2+ , so that the blood appears light blue. Hemocyanin is a multifunctional protein. In addition to its main function of oxygen transport, hemocyanin also plays a role in metal ion transport, protein storage, osmotic pressure regulation, ecdysone carrier, and epidermal solidification. There is increasing evidence that it also plays an important role in the immune response, the most well-studied of which is p...

Examples

Embodiment 1

[0033] Example 1: Extraction and Identification of Hemocyanin (Hc)

[0034] 1. Preparation of crude hemocyanin

[0035] Add the hemolymph of abalone variegated into a 1.5mL Eppendorf tube, centrifuge at 8,000rpm, 4°C for 30min, discard the precipitate, centrifuge the supernatant at 10,000rpm, 4°C for 30min, discard the precipitate, then centrifuge at 30,000rpm, 4°C for 1.5h, discard the supernatant It can be seen that there is a blue precipitate at the bottom of the tube, and crude hemocyanin is obtained. Add 1mL PBS buffer to the blue pellet to resuspend the pellet and store at -20°C.

[0036] 2. Purification of hemocyanin by density gradient centrifugation

[0037] Prepare 4 concentrations of CsCl solutions with PBS buffer and place them in gradient tubes, from the bottom of the tube to the top of the tube, they are 45%, 35%, 25%, and 15% (V / W). Add the hemocyanin extracted in step 1 to the top layer of the gradient tube, then centrifuge at 35000rpm, 4°C for 16h. A blu...

Embodiment 2

[0043] Example 2: Determination of Hemocyanin (Hc) Phenoloxidase Activity

[0044] 1. Determination of Hemocyanin Phenoloxidase Activity

[0045] The absorbance values ​​of the purified hemocyanin (Hc) obtained in step 2 of Example 1 at different wavelengths were detected by an ultraviolet-visible spectrophotometer, and the concentration of Hc was detected by the Coomassie Brilliant Blue method. Determination of phenoloxidase activity was divided into control group and experimental group. The control group used PBS instead of variegated abalone hemocyanin, and the others were the same as the experimental group. In the experimental group, 100 μL of 3 mg / mL hemocyanin was added to 2.8 mL of PBS buffer, placed in a water bath at 25°C, and left to stand for 15 minutes; 100 μL of 18 mmol / L catechol was added, mixed well, and its Absorbance at 400nm. Repeat 3 times. Calculate the initial velocity of the reaction:

[0046] Vi=(TODe-TODc) / 3×molar absorptivity,

[0047] Among the...

Embodiment 3

[0051] Example three: HdHc1 and HdHc2 gene extraction

[0052] 1. Design of primers for HdHc1 and HdHc2 gene library screening

[0053] According to the HdHc1 and HdHc2 peptide sequences identified by mass spectrometry in Example 1, and the European tumor abalone (Haliotis tuberculata) hemocyanin type I and II subunit gene sequences (AJ252741 and AJ297475) with 90% homology in NCBI, design Specific primers were used to screen the complete gene sequences of HdHc1 and HdHc2 from the variegated abalone genome library.

[0054] The upstream primer of HdHc1: GAGCAGGTATGGTTCTTTCAGTATTCTTTC;

[0055] Downstream primer of HdHc1: AGTATCTTCTACGCACTTTTACAATAACGGA;

[0056] The upstream primer of HdHc2: ATCATGACTACGATGTTCTT;

[0057] Downstream primer for HdHc2: TACCACACAGTTGAAGAG.

[0058] 2. Preparation of Genomic Library of Abalone variegated Fosmid

[0059] 2.1 Genomic DNA extraction and fragmentation

[0060] Take 5 g of fresh mature variegated abalone muscle tissue, grind it...