Unlock instant, AI-driven research and patent intelligence for your innovation.

Optimized sulfide quinine oxidation-reduction enzyme gene and expression vector thereof

An expression vector, eukaryotic expression vector technology, applied in the field of genetic engineering, to achieve the effect of solving the problem of environmental pollution

Inactive Publication Date: 2014-07-30
SOUTH CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the gene optimization of SQR protein is still blank.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized sulfide quinine oxidation-reduction enzyme gene and expression vector thereof
  • Optimized sulfide quinine oxidation-reduction enzyme gene and expression vector thereof
  • Optimized sulfide quinine oxidation-reduction enzyme gene and expression vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] 1. Cloning of the sqr gene of Rhodobacter capsularis

[0041] The purchased rhodobacter capsulata were resuscitated and expanded for culture.

[0042] Referring to the sqr gene sequence of Rhodobacter capsulata DSM155 (Accession No. X97478.2) on GenBank, a pair of primers S1 were designed using software such as primer5.0 and Genetool:

[0043] F: 5'GAGCTGGCCGGTCTGAACTTC 3' (SEQ ID NO: 2);

[0044] R: 5'CGCGCCTGTCCTTCGCCTCCGTGACA 3' (SEQ ID NO: 3).

[0045] Using the above primers, the sqr gene was amplified by conventional PCR using the extracted Rhodobacter capsularis genomic DNA as a template. The electrophoresis detection results of the amplified products were as follows: figure 1 , a band of about 1550bp can be seen. The PCR product was recovered and purified according to the instructions of the Omega PCR Product Purification and Recovery Kit. After sequencing, the fragment length was 1547bp, including the full-length CDS of the sqr gene of 1284bp.

[0046] 2. S...

Embodiment 2

[0068] Example 2 Expression of sqr gene in CHO cell line before and after optimization

[0069] Construction of eukaryotic expression vector pcDNA3.1-sqr / sqr2: designed to contain xho I and Kpn The sequence primer S3 of I cohesive end, the sequence is as follows:

[0070] F:5′-CCG CTCGAG ATGTTTCAACTTTGGAAACTTGTTTTCTTGTGCGGTCTGCTCATTGGGACCTCAGCGTCTATGGCTCATATCGTG-3' (SEQ ID NO: 6, xho I);

[0071] R: 5′-CGG GGTACC GACCCTTCTTCACGGCCTT-3' (SEQ ID NO: 7, Kpn I).

[0072] The gene sequences of sqr and sqr2 were respectively used as templates and S3 as primers for conventional PCR amplification. After the amplified products were cloned by the cloning vector, they were double-digested with the plasmid pcDNA3.1, and the digested products were connected with ligase to construct new expression vectors pcDNA3.1-sqr and pcDNA3.1-sqr2.

[0073] The constructed eukaryotic expression recombinant vectors pcDNA3.1-sqr and pcDNA3.1-sqr2 were sequenced and used xho I and Kp...

Embodiment 3

[0079] Example 3 Preparation of sqr2 transgenic mice by microinjection

[0080] The optimized gene sqr2 was inserted into the multi-cloning site of the transgene vector to construct a transgene expression vector, and microinjected into mice (completed by Guangzhou Saiye Company), a total of 350 fertilized eggs were injected, and 200 were injected for the first time , 155 survived, 6 surrogate mice were transplanted, and 9 mice were born (some died). 150 eggs were injected for the second time, 110 survived, 4 surrogate mice were transplanted, and 17 mice were born.

[0081] The founder transgenic mice mated with non-transgenic mice for the first time at about 6 weeks of age, and obtained F 1 After weaning, the mice were mated again. The passage status of the mice is shown in Table 1. Perform PCR detection on the born offspring mice, and the heritability can be calculated according to the number of positive transgenic mice. The results showed that the 15th and 35th pPSP-sqr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an optimized sulfide quinone oxidoreductase gene and its expression carrier, belonging to the technical field of genetic engineering. The optimized sulfide quinone oxidoreductase gene (sqr) nucleotide sequence is shown in SEQ ID NO:1. The similarity between the optimized nucleotide sequence of the sqr gene fragment and the original sequence was 81%, and the codons of 228 amino acids among the 427 amino acids were optimized, and the optimization rate reached 54%. From the perspective of cultivating new environmentally friendly animal varieties, the present invention explores the way for the preparation of transgenic animals, in order to reduce the emission of hydrogen sulfide gas in animal farms from a new perspective of transgenic, and fundamentally solve the problem of environmental pollution in the breeding industry .

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an optimized quinone sulfide oxidoreductase gene and an expression vector thereof. Background technique [0002] The waste gas produced by large-scale pig raising in animal husbandry has caused great pollution to the surrounding environment, while H 2 S is one of the important factors that produce foul odor, which can reduce the production performance of livestock and poultry, cause poisoning and death of young, and have a great impact on agricultural production and people's lives. With the development of transgenic technology, the cultivation of emission-reducing H 2 S's environment-friendly transgenic pigs become possible, which can fundamentally alleviate the environmental problems in farms. Photosynthetic bacteria Rhodobacter capsulata ( Rhodobacter capsulatus ) produces a membrane-bound protein-sulfide-quinone oxidoreductase (Sulfide-quinone reductase, SQR), w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N15/63C12N1/21C12N5/10C12N15/85A01K67/027C12R1/01
Inventor 李加琪贺艳芬张哲张豪
Owner SOUTH CHINA AGRI UNIV