Method for producing alpha amylase

An α-amylase and gene expression technology, which is applied in the field of constructing microbial engineering bacteria to produce recombinant proteins and producing mixed α-amylases, can solve the problems of narrow suitable reaction temperature range and suitable reaction pH range, high nutritional requirements, and slow growth, etc. To achieve the effect of saving raw materials

Inactive Publication Date: 2012-10-24
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the slow growth of natural α-amylase-producing strains and higher nutritional requirements, the production cost of the enzyme is higher; in addition, the suitable reaction temperature range and suitable reaction pH range of the current α-amylase products are narrow, which cannot meet current market needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing alpha amylase
  • Method for producing alpha amylase
  • Method for producing alpha amylase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1.1 Construct the Pichia pastoris expression vector containing the α-amylase gene expression framework of barley, the α-amylase gene expression framework of Bacillus licheniformis and the α-amylase gene expression framework of Aspergillus

[0023] 1.1.1 Construction of cloning vector

[0024] A professional DNA sequence synthesis company synthesizes two complementary double strands containing ampicillin (AMP) gene sequence, polyclonal linker and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pPD.

[0025] 1.1.2 Acquiring genes

[0026] ①Amplification of barley α-amylase gene by reverse transcription PCR

[0027] Primer 1: 5'GGC GAATTC caagtcctctttcaggggtt3'3'[Description: The 8 bases at 5' are enzyme-cleaved protection bases (2 bases) and enzyme recognition site (6 bases with underline)]

[0028] Primer 2: 5'CA ...

Embodiment 2

[0077] 2.1 Construction of Saccharomyces cerevisiae expression vectors containing the α-amylase gene expression framework of barley, the α-amylase gene expression framework of Bacillus licheniformis and the α-amylase gene expression framework of Aspergillus

[0078] 2.1.1 Construction of cloning vector

[0079] A professional DNA sequence synthesis company synthesizes two complementary double strands containing ampicillin (AMP) gene sequence, polyclonal linker and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pSD.

[0080] 2.1.2 Acquiring genes

[0081] ①Amplification of barley α-amylase gene by reverse transcription PCR

[0082] Primer 1: 5'GGC GAATTCcaagtcctctttcaggggtt3'3'[Description: The 8 bases at 5' are enzyme-cleaved protection bases (2 bases) and enzyme recognition site (6 bases with underline)]

[0083] Primer...

Embodiment 3

[0137] 3.1 Construction of the Bacillus subtilis expression vector containing the α-amylase gene expression framework of barley, the α-amylase gene expression framework of Bacillus licheniformis and the α-amylase gene expression framework of Aspergillus

[0138] 3.1.1 Construction of cloning vector

[0139] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pBD.

[0140] 3.1.2 Acquiring genes

[0141] ①Amplification of barley α-amylase gene by reverse transcription PCR

[0142] Primer 1: 5'GGC GAATTC caagtcctctttcaggggtt3'3'[Description: The 8 bases at 5' are enzyme-cleaved protection bases (2 bases) and enzyme recognition site (6 bases with underline)]

[0143]Prim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing alpha amylase, belonging to the biological technical field, comprising the steps of cloning alpha amylase genes of barley, bacillus licheniformis and aspergillus respectively; constructing Pichia expression vector, saccharomyces cerevisiae expression vector and bacillus subtilis expression vector containing three alpha amylase gene expression frameworks; transforming the vectors to be corresponding host strains; screening high-expression alpha amylase recombinants as engineering bacteria; fermenting Pichia engineering bacterium, saccharomyces cerevisiae engineering bacterium and aspergillus engineering bacterium to produce recombined and mixed alpha amylase. Compared with the traditional alpha amylase coded by single gene, the combined and mixed alpha amylase produced by the method can be suitable for wide reaction temperature and pH range, thus being suitable for various applications; the yield of the alpha amylase expressed by the engineering bacterium containing multi-gene expression framework is notably higher than that of the alpha amylase expressed by engineering bacterium containing single gene, and therefore, the production cost can be reduced.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the construction of microbial engineering bacteria to produce recombinant proteins. Specifically, the mixed α-amylase is produced by using microbial engineering bacteria. Background technique [0002] α-amylase (α-amylase, EC 3.2.1.1) widely exists in the biological world. Alpha-amylase catalyzes the random hydrolysis of the alpha-1,4-glucosidic linkages of starch to produce maltose, maltotriose and alpha-dextrin. α-amylase is widely used in industries such as maltose, beer, rice wine, glucose, alcohol, liquor, monosodium glutamate and medicine. The alpha amylase products currently on the market are derived from alpha amylase produced by natural strains. However, due to the slow growth of natural α-amylase-producing strains and higher nutritional requirements, the production cost of the enzyme is higher; in addition, the suitable reaction temperature range and suitable reaction pH ra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/32C12N9/30C12N9/28C12N15/81C12N15/75C12R1/10C12R1/66C12R1/84C12R1/865C12R1/125
Inventor张爱联罗进贤张添元符仙刘振旺
OwnerINST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI