Method for producing alpha amylase
An α-amylase and gene expression technology, which is applied in the field of constructing microbial engineering bacteria to produce recombinant proteins and producing mixed α-amylases, can solve the problems of narrow suitable reaction temperature range and suitable reaction pH range, high nutritional requirements, and slow growth, etc. To achieve the effect of saving raw materials
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] 1.1 Construct the Pichia pastoris expression vector containing the α-amylase gene expression framework of barley, the α-amylase gene expression framework of Bacillus licheniformis and the α-amylase gene expression framework of Aspergillus
[0023] 1.1.1 Construction of cloning vector
[0024] A professional DNA sequence synthesis company synthesizes two complementary double strands containing ampicillin (AMP) gene sequence, polyclonal linker and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pPD.
[0025] 1.1.2 Acquiring genes
[0026] ①Amplification of barley α-amylase gene by reverse transcription PCR
[0027] Primer 1: 5'GGC GAATTC caagtcctctttcaggggtt3'3'[Description: The 8 bases at 5' are enzyme-cleaved protection bases (2 bases) and enzyme recognition site (6 bases with underline)]
[0028] Primer 2: 5'CA ...
Embodiment 2
[0077] 2.1 Construction of Saccharomyces cerevisiae expression vectors containing the α-amylase gene expression framework of barley, the α-amylase gene expression framework of Bacillus licheniformis and the α-amylase gene expression framework of Aspergillus
[0078] 2.1.1 Construction of cloning vector
[0079] A professional DNA sequence synthesis company synthesizes two complementary double strands containing ampicillin (AMP) gene sequence, polyclonal linker and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pSD.
[0080] 2.1.2 Acquiring genes
[0081] ①Amplification of barley α-amylase gene by reverse transcription PCR
[0082] Primer 1: 5'GGC GAATTCcaagtcctctttcaggggtt3'3'[Description: The 8 bases at 5' are enzyme-cleaved protection bases (2 bases) and enzyme recognition site (6 bases with underline)]
[0083] Primer...
Embodiment 3
[0137] 3.1 Construction of the Bacillus subtilis expression vector containing the α-amylase gene expression framework of barley, the α-amylase gene expression framework of Bacillus licheniformis and the α-amylase gene expression framework of Aspergillus
[0138] 3.1.1 Construction of cloning vector
[0139] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pBD.
[0140] 3.1.2 Acquiring genes
[0141] ①Amplification of barley α-amylase gene by reverse transcription PCR
[0142] Primer 1: 5'GGC GAATTC caagtcctctttcaggggtt3'3'[Description: The 8 bases at 5' are enzyme-cleaved protection bases (2 bases) and enzyme recognition site (6 bases with underline)]
[0143]Prim...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
