Glucoamylase producing method

A technology of glucoamylase and gene expression, which is applied in the field of constructing microbial engineering bacteria to produce recombinant protein and producing recombinant glucoamylase, which can solve the problem of narrow reaction temperature range and suitable reaction pH range, and cannot satisfy the reaction temperature and suitable reaction pH range Demand and other issues to achieve the effect of saving raw materials

Inactive Publication Date: 2012-10-24
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the current enzyme products are derived from a single enzyme gene code, the suitable reaction temperature range and suitable reaction pH range are narrow, and cannot meet the needs of different uses for various suitable reaction temperatures and suitable reaction pH ranges of enzymes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glucoamylase producing method
  • Glucoamylase producing method
  • Glucoamylase producing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1.1 Pichia pastoris expression vector containing the glucoamylase gene expression framework of Aspergillus, the glucoamylase gene expression framework of Chaetomium and the glucoamylase gene expression framework of yeast

[0023] 1.1.1 Construction of cloning vector

[0024] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pPA.

[0025] 1.1.2 Acquiring genes

[0026] ① Amplification of Aspergillus glucoamylase gene by reverse transcription PCR

[0027] Primer 1: 5'CT GGATCC atgtcgttccgatctcttct3'[Description: The 8 bases of 5' are the restriction enzyme protection bases (2 bases) and the enzyme recognition site (6 underlined bases)]

[0028] Primer 2: 5'aa ...

Embodiment 2

[0075] 2.1 Saccharomyces cerevisiae expression vector containing the glucoamylase gene expression framework of Aspergillus, the glucoamylase gene expression framework of Chaetomium and the glucoamylase gene expression framework of yeast

[0076] 2.1.1 Construction of cloning vector

[0077] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pSA.

[0078] 2.1.2 Acquiring genes

[0079] ④ Amplification of Aspergillus glucoamylase gene by reverse transcription PCR

[0080] Primer 1: 5'CT GGATCC atgtcgttccgatctcttct3'[Description: The 8 bases of 5' are the restriction enzyme protection bases (2 bases) and the enzyme recognition site (6 underlined bases)]

[0081] Primer...

Embodiment 3

[0134] 3.1 Bacillus subtilis expression vector containing the glucoamylase gene expression framework of Aspergillus, the glucoamylase gene expression framework of Chaetomium and the glucoamylase gene expression framework of yeast

[0135] 3.1.1 Construction of cloning vector

[0136] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pBA.

[0137] 3.1.2 Acquiring genes

[0138] Amplification of Aspergillus Glucoamylase Gene by Reverse Transcription PCR

[0139] Primer 1: 5'CT GGATCC atgtcgttccgatctcttct3'[Description: The 8 bases of 5' are the restriction enzyme protection bases (2 bases) and the enzyme recognition site (6 underlined bases)]

[0140] Primer 2: 5'aa ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a glucoamylase producing method and belongs to the technical field of biology. The glucoamylase producing method includes: firstly, cloning glucoamylase genes of aspergillus, chaetomium and yeast; secondly, constructing a pichia pastoris expression vector, a saccharomyces cerevisiae expression vector and a bacillus subtilis expression vector which include three glucoamylase gene expression cassettes, and transforming the vectors to corresponding host bacteria respectively; thirdly, respectively screening recombinants of over-expression glucoamylases as engineering bacteria; and finally, fermenting the pichia pastoris engineering bacteria, the saccharomyces cerevisiae engineering bacteria and the bacillus subtilis engineering bacteria to produce a recombinant mixed glucoamylase. Different from a traditional single-gene-coded glucoamylase, the recombinant mixed glucoamylase is wide in suitable reaction temperature and pH (potential of hydrogen) range and suitable for various purposes, and yield of the glucoamylase is remarkably increased by the aid of implementation of expression of the three glucoamylase genes in the engineering bacteria, so that production cost is reduced.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the construction of microbial engineering bacteria to produce recombinant proteins. Specifically, the recombinant glucoamylase is produced by using microbial engineering bacteria. Background technique [0002] Glucoamylase [Glucoamylase, (EC.3.2.1.3.)], also known as glucoamylase, can hydrolyze starch from the non-reducing end to α-1.4 glucosidic bonds to produce glucose, and can also slowly hydrolyze α-1.6 glucosidic bonds , converted to glucose. At the same time, it can also hydrolyze dextrin, and the non-reducing wood end of glycogen releases β-D-glucose. It is used in brewing, glucose, fructose syrup, antibiotics, lactic acid, organic acids, monosodium glutamate, cotton spinning mills, etc. It is the enzyme with the largest production volume and the widest range of applications in the world. Glucoamylase products currently on the market are derived from natural strains producing ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/56C12N15/81C12N15/75C12N1/19C12N1/21C12N9/34C12R1/125C12R1/84C12R1/865
Inventor张爱联罗进贤刘振旺张添元符仙沈锦城
OwnerINST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI