Prawn white spot syndrome virus multivalent vector vaccine and application thereof

A technology of white spot syndrome and vector vaccine, which is applied in the field of genetic bioengineering, achieves the effects of making up for technical application defects, good multivalent prevention and control effect, and remarkable immune effect

Active Publication Date: 2012-11-07
JIANGSU HAIJIAN CUTTING EDGE BIOTECH
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The purpose of the present invention is to overcome the deficiencies in the prior art, provide a kind of prawn white spot syndrome virus polyvalent carrier vaccine and its application, it uses a strain of non-pathogenic Vibrio anguillaris wild strain HT5301 as carrier bacterial strain, uses this The vaccine prepared by the strain has the ability to protect shrimp from the infection of Vibrio anguillarum. At the same time, it does not have the pathogenicity of Vibrio anguillarum but retains the invasiveness of shrimp. It can be administered by soaking and oral administration to achieve a natural injection effect The purpose of vaccination is to make up for the technical application defects of single potency and inconvenient administration. It is simple and convenient to use, and provides a multi-potency, safe and economical vaccine for the prevention and treatment of shrimp white spot syndrome virus disease and vibriosis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prawn white spot syndrome virus multivalent vector vaccine and application thereof
  • Prawn white spot syndrome virus multivalent vector vaccine and application thereof
  • Prawn white spot syndrome virus multivalent vector vaccine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Preparation of a recombinant Vibrio anguillarum vector vaccine displaying VP19 on the surface of the ice nucleation protein INP as the carrier protein.

[0051] 1 Molecular biology operation

[0052] 1.1 Acquisition of ice nucleation protein INP gene

[0053] Genomic DNA of Pseudomonas syringae pathogenic species ICMP3203 was extracted with bacterial genomic DNA rapid extraction kit (purchased from Sangon Bioengineering Shanghai Co., Ltd., SK8225), and stored at -20°C for future use.

[0054] 1.2 Molecular biology techniques

[0055] All plasmid constructions were carried out using standard molecular biology techniques described by Sambrook et al. All recovered DNA fragments used in the present invention were separated and purified using Sangon Bioengineering Shanghai Co., Ltd. Gel Recovery Kit, and all sequencing was performed by Sangon Bioengineering Shanghai Co., Ltd. sequencing.

[0056] 1.3PCR amplification

[0057] The primers used for gene amplific...

Embodiment 2

[0088] Example 2: Preparation of a recombinant Vibrio anguillarum vector vaccine displaying VP28 on the surface of the ice nucleation protein INP as the carrier protein.

[0089] 1 Molecular biology operation

[0090] The specific operation method is the same as the molecular biology operation in the embodiment of the present invention 1

[0091] The primers for PCR amplification are as follows:

[0092] INP-F: GCCGAATTCTGAGGATGCTGTAATGAA

[0093] INP-R: GCCGGTACCAAATCAGATCACTGTG

[0094] VP28-FB':CGGGATCCCACAACACTGTGACCAAG

[0095] VP28-R: CGGAATTCTTACTCGGTCTCAGTGCCAGAG

[0096] 2 Construction of recombinant plasmids

[0097] (1) Use EcoRI and BamHI to double-digest the ice nuclei protein INP gene fragment and plasmid pUC18. The digested fragments are ligated overnight at 16°C, and then transformed into E. coli Top10, and the recombinants are screened, and the recombinant plasmids are extracted for double-enzyme Cut and sequenced the clones that had been digested correc...

Embodiment 3

[0104] Example 3: Preparation of freeze-dried vaccine products.

[0105] Cultivation of vector vaccines: Take 1 inoculation of the basic seeds of vector vaccine strains ( Prepared in Example 1), inoculated in a 500ml Erlenmeyer flask containing 100ml liquid LB seed medium (soy peptone 10g / L, yeast extract 5g / L, NaCl 25g / L, pH 7.6, 100mg / ml ampicillin), Shake culture at constant temperature at 26°C (200 rpm). After 12 hours, inoculate the vigorously growing vaccine bacteria solution (OD=4.0 or so) into fresh iron-rich LB fermentation medium (soybean peptone 10g / L, yeast extract 5g / L, NaCl 25g / L) at an inoculation volume of 3%. , ferric ammonium citrate 0.2-0.5mmol, pH 6.8-7.2), 26 ℃ constant temperature shaking culture for 16-18 hours and then collect the vaccine fermentation liquid for later use.

[0106] Vaccine freeze-drying preparation: add trehalose and skimmed milk powder as freeze-drying protective agent (sterilization) to the polyvalent carrier vaccine according to th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a prawn white spot syndrome virus multivalent vector vaccine and application thereof. The multivalent vector vaccine is a recombinant vibrio anguillarum containing envelope protein VP19 gene segment or VP28 gene fragment of the prawn white spot syndrome virus. The VP19 protein or the VP28 protein exist on the surface of the recombinant vibrio anguillarum cells. According to the invention, a strain of non-pathogenic vibrio anguillarum wild strain HT5301 is used as a vector strain; a vaccine prepared from the strain has ability to protect prawn from infection of vibrio anguillarum; besides, the vaccine does not have pathogenicity of the vibrio anguillarum but retains invasiveness on the shrimp, and can be administered through soaking and oral administration, so as to realize vaccination with natural injection effect and compensate for defects of single valence and inconvenient administration. The vaccine is simple and convenient for usage, and is a multivalent, safe, and economical vaccine for control of prawn white spot syndrome virus and vibriosis.

Description

technical field [0001] The invention relates to carrier vaccine technology, in particular to shrimp white spot syndrome virus (WSSV) polyvalent carrier vaccine and its application, belonging to the technical field of genetic bioengineering. Specifically, it relates to a vibrio anguillaris recombinant vector vaccine and its application displaying the antigenic protein of prawn white spot syndrome virus on its surface. Background technique [0002] Shrimp is a high-value aquatic product mainly produced in Asia and Latin America for export purposes. At present, the main cultured species are Penaeus vannamei, Penaeus monodon and Penaeus chinensis. Among them, Penaeus vannamei has become the largest species of prawns in my country. , with an annual output of more than 700,000 tons, ranking first in the world. However, in the past 20 years, there have been quite serious problems in the production of shrimp farming mainly due to vibriosis and viral diseases, among which white spot ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/385A61K39/295A61K47/42A61P31/20A61P31/04C12N1/21C12N15/40A61K39/12A61K39/106C12R1/63
Inventor不公告发明人
OwnerJIANGSU HAIJIAN CUTTING EDGE BIOTECH