Supercharge Your Innovation With Domain-Expert AI Agents!

Applications of ARID1A gene and protein product encoded by the same

A technology of encoding protein and protein products, which is applied in the field of tumor diagnosis and treatment, can solve the problems of liver cancer occurrence, metastasis, and unclear genetic events of liver cancer, and achieve the effect of inhibiting proliferation and metastasis and accurate diagnosis

Inactive Publication Date: 2012-12-05
CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although previous studies have found that the inactivation of tumor suppressor genes, such as TP53, and the activation of oncogenes, such as β-catenin and gp130, are all caused by somatic mutations in liver cancer, the genetic events in the development of liver cancer have not yet been very clear
It is known that genetic changes are necessary for tumorigenesis and metastasis, but so far only a few genes with relatively low frequency of somatic mutations have been found in clinical liver cancer samples, suggesting that there may be somatic mutations of other important genes that can lead to the occurrence and development of liver cancer. transfer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of ARID1A gene and protein product encoded by the same
  • Applications of ARID1A gene and protein product encoded by the same
  • Applications of ARID1A gene and protein product encoded by the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 110

[0045] Example 110 Exome Capture Sequencing of Liver Cancer Patients

[0046] 1. Tissue sample collection and DNA extraction

[0047] Collect paracancerous tissue, cancer tissue, and portal vein tumor thrombus tissue samples from 10 patients with liver cancer (30 tissue samples in total), and use the tissue DNA extraction kit from QIAGEN, Germany, to perform tissue DNA extraction according to the experimental procedures in the product manual . The quality of the extracted DNA was verified. Except for the DNA degradation of the portal vein tumor thrombus tissue in one patient, the DNA quality of the other 29 tissue samples met the requirements.

[0048] 2. Exome Capture

[0049] Genomic DNA was randomly broken into fragments of about 500bp, and then adapters were connected to both ends of the DNA fragments. The DNA fragments that passed the PCR library check were hybridized with the NimbleGen 2.1M Human Exome Array chip. After removing the background DNA not bound to the ch...

Embodiment 2

[0063] The Sanger method sequencing of embodiment 2PCR product

[0064] 1. PCR amplification of specific DNA fragments in the coding region of the ARID1A gene

[0065] The primer sequences are:

[0066] Forward primer: TGCGTGTCCTTTGTTATATTGG (SEQ ID NO: 1);

[0067] Reverse primer: TCAGATCAGTCACCTTTTCCTCA (SEQ ID NO: 2).

[0068] High-fidelity hot-start DNA polymerase Hotstar Taq is used.

[0069] The PCR reaction system is: forward primer, reverse primer, 10X PCR buffer, Mgcl 2, dNTP, Hotstar Taq DNA polymerase, and DNA template, the volumes of each component are 0.5, 0.5, 5, 1, 0.5, 0.1, 1 μl, and finally add sterilized deionized water to make the reaction system 50 μl.

[0070] The PCR reaction conditions were: denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds in each cycle; PCR amplification products were detected by electrophoresis and PCR products we...

Embodiment 3

[0075] Example 3 Sequencing Analysis of ARID1A Gene Coding Sequence in Liver Cancer Patient Tissue by Sanger Method

[0076] 1. Tissue Sample Collection

[0077] The tissue samples of 100 pairs of liver cancer patients were obtained from surgically excised cancer tissue and paracancerous tissue samples of liver cancer patients in hospitals in Guilin, Guangxi, Wuxi, Jiangsu, and Suzhou, Jiangsu. All tissue samples were frozen and stored at -80°C. The human tissue manipulations involved were approved by the Ethics Committee of the National Human Genome Southern Research Center.

[0078] 2. DNA extraction

[0079] Tissue DNA extraction kits from QIAGEN, Germany were used to extract tissue DNA according to the experimental procedures in the product manual.

[0080] 3. PCR amplification of the nucleic acid sequence encoded by the ARID1A gene

[0081] The ARID1A gene consists of 20 exons (expressed region, Exon), and the encoded nucleic acid sequence (CCDS285.1) is derived from t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses applications of ARID1A gene and a protein product encoded by the ARID1A gene, wherein the ARID1A gene and the protein product encoded by the ARID1A gene are provided for preparations of products for cancer diagnosis and drugs for cancer treatment. The ARID1A gene and the protein product encoded by the ARID1A gene in the present invention can be used as cancer-specific marker gene, such that cancer diagnosis is rapid and accurate. In addition, the ARID1A gene and the protein product encoded by the ARID1A gene in the present invention can further be used for preparations of drugs for inhibition of cancer cell growth and metastasis so as to provide a new approach for cancer treatment.

Description

technical field [0001] The invention relates to the field of diagnosis and treatment of tumors, in particular to the application of ARID1A gene and its encoded protein product in the diagnosis and treatment of tumors. Background technique [0002] Liver cancer causes 600,000 deaths every year, and is one of the malignant tumors that seriously threaten the health of our people. The pathogenesis of liver cancer involves many factors, including hepatitis B virus, hepatitis C virus, alcohol, and aflatoxin pollution. In my country's liver cancer patients, hepatitis B virus infection is the main factor. The activation of oncogenes and the inactivation of tumor suppressor genes are the molecular mechanisms of liver cancer. Although previous studies have found that the inactivation of tumor suppressor genes, such as TP53, and the activation of oncogenes, such as β-catenin and gp130, are all caused by somatic mutations in liver cancer, the genetic events in the development of liver...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N15/113C12N15/11A61K48/00A61K38/43A61P35/00A61P35/04G01N33/574
Inventor 邓庆韩泽广王群李坤雨
Owner CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More