Genetic engineering strain enriched with heavy cadmium, as well as construction and application thereof

A genetically engineered bacteria, enrichment technology, applied in the construction of cadmium-enriched genetically engineered bacteria and the characterization of the function of a strain obtained from the construction, cadmium-enriched genetically engineered bacteria and its construction field, can solve the problem of low efficiency, reduce Soil fertility, changing the physical and chemical structure of soil, etc., to achieve the effect of improving the tolerance of heavy metal cadmium, improving tolerance, and good phytoremediation

Inactive Publication Date: 2013-02-13
NANJING UNIV OF TECH
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, most heavy metals can stay in the environmental soil for a long time, and traditional physical and chemical methods are used to repair them, including the use of chemical reagents to extract, electrochemistry, burying on the spot, etc., which are often too expensive and inefficient, and even change the physical and chemical properties of the soil. Chemical structure that greatly reduces soil fertility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering strain enriched with heavy cadmium, as well as construction and application thereof
  • Genetic engineering strain enriched with heavy cadmium, as well as construction and application thereof
  • Genetic engineering strain enriched with heavy cadmium, as well as construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] This example illustrates the construction of an expression gene SpPCS The intermediate plasmid pMD19-T- SpPCS Methods. The process includes:

[0049] 1. Design and synthesize upstream primers and downstream primers without restriction sites,

[0050] Primer1 upstream primer: 5'- ATGAACATTGTTAAACGAGCA -3';

[0051] Primer2 downstream primer: 5'- TCACGTATTTTTACAGCA -3'.

[0052] 2. Using Schizosaccharomyces pombe genomic DNA as a template, PCR amplified the target gene fragment, the results are shown in figure 1 , the reaction conditions were: 94 °C pre-denaturation for 5 min; 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1.5 min, 72 °C for 5 min, 30 cycles. PCR amplified SpPCS After the gene, it was connected to the sequencing carrier PMD19-T Simple plasmid by T-A cloning, and the correct transformant was picked, sequenced, and compared correctly, and the expression gene was obtained SpPCS The intermediate plasmid pMD19-T- SpPCS .

Embodiment 2

[0054] This example illustrates the construction of an expression gene SpPCS The recombinant plasmid pBBR1MCS-5- SpPCS method, see the specific construction method figure 2 . The process includes:

[0055] 1. Contains genes SpPCS The recombinant plasmid pBBR1MCS-5- SpPCS build,

[0056] (1) Synthesis with Sal1 The upstream primer of the restriction site and the downstream primer of the EcoR1 restriction site:

[0057] Primer3 upstream primer:

[0058] 5'-GCG GTC GAC ATGAACATTGTTAAACGAGCA -3';

[0059] Primer4 downstream primer:

[0060] 5'- GGG GATATC TCACGTATTTTTACAGCA-3'.

[0061] (2) with PMD19-T- SpPCS As a template, the target gene fragment was amplified by PCR. The reaction conditions were as follows: PCR reaction conditions were: 94°C pre-denaturation for 5 minutes; 94°C for 30 s, 55°C for 30 s, 72°C for 1.5 min, 72°C for 5 min, 30 cycles. Purified and amplified with enzyme cleavage site SpPCS After the gene, it was ligated with the pBBR1MCS...

Embodiment 3

[0063] This example illustrates that the constructed recombinant plasmid pBBR1MCS-5- SpPCS Electroporation transformation is introduced into the competent cells of Pseudomonas putida KT2440, and the positive transformant KT2440-SpPCS is obtained by screening with 50 μg / mL gentamicin.

[0064] (1) Preparation of KT2440 competent cells: Activate the KT2440 strain on the plate; pick a single colony after 20 hours and inoculate it in 5 mL LB seed solution; transfer it to 100 mL LB culture solution after 12 hours according to the inoculum amount of 1%; When OD600=0.6~0.75, immediately put it on ice for 20 minutes; 4°C, 5000 r / min, centrifuge for 10 minutes to collect the bacteria, wash the bacteria with HEPES buffer (3 mM, pH=7.0) 3 times; add 500 μL Resuspend in HEPES buffer, add 500 μL of 20% glycerol, aliquot each 50 μL for one electroporation.

[0065] (2) Electric transformation conditions: take 50 ng of the recombinant plasmid, and use the following electroporation transfor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological engineering, relates to a cadmium-enriched genetic engineering strain, and a construction and an application thereof, and in particular relates to the construction of the cadmium-enriched genetic engineering strain and a strain formed by construction of the cadmium-enriched genetic engineering strain, as well as representation of cadmium tolerance, cadmium absorption and other functions of the strain. The genetic engineering strain enriched with heavy cadmium, which is obtained by adopting the construction method disclosed by the invention, is classified and named as Pseudomonasputida KT2440-SpPCS, and the collection number is CCTCCNO: M 2012435. The construction process is mainly as follows: a molecular biology means is used for heterologous expression of Schizosaccharomycespombe phytochelatin in Pseudomonas putida KT2440 for synthesizing an enzyme gene SpPCS, and the genetic engineering strain obtained by the construction method disclosed by the invention can be used as a plant growth promoting bacteria so as to lay a foundation for follow-up research of repair of a heavy metal by coordination and synergy with a plant.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a cadmium-enriched genetically engineered bacterium and its construction method and application, specifically refers to the construction of a cadmium-enriched genetically engineered bacterium and a bacterial strain obtained by the construction, and also relates to the cadmium tolerance and cadmium tolerance of the bacterial strain Characterization of functions such as cadmium uptake. Background technique [0002] A large number of heavy metals produced by industrial and agricultural production activities have caused serious harm to humans and the ecological environment, such as Cd, Hg, As, Pb, etc., which can replace Zn, Fe, Cu and some other non-heavy metal elements, destroying them as some Cofactors of proteins and enzymes, thereby interfering with the normal physiological metabolic activities of organisms. Moreover, most heavy metals can stay in the environmental soil fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/52C12N15/63B09C1/10C12R1/40
Inventor郑涛刘伟陈怡露陈璞雍晓雨周俊
OwnerNANJING UNIV OF TECH