Genetic engineering strain enriched with heavy cadmium, as well as construction and application thereof
A genetically engineered bacteria, enrichment technology, applied in the construction of cadmium-enriched genetically engineered bacteria and the characterization of the function of a strain obtained from the construction, cadmium-enriched genetically engineered bacteria and its construction field, can solve the problem of low efficiency, reduce Soil fertility, changing the physical and chemical structure of soil, etc., to achieve the effect of improving the tolerance of heavy metal cadmium, improving tolerance, and good phytoremediation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] This example illustrates the construction of an expression gene SpPCS The intermediate plasmid pMD19-T- SpPCS Methods. The process includes:
[0049] 1. Design and synthesize upstream primers and downstream primers without restriction sites,
[0050] Primer1 upstream primer: 5'- ATGAACATTGTTAAACGAGCA -3';
[0051] Primer2 downstream primer: 5'- TCACGTATTTTTACAGCA -3'.
[0052] 2. Using Schizosaccharomyces pombe genomic DNA as a template, PCR amplified the target gene fragment, the results are shown in figure 1 , the reaction conditions were: 94 °C pre-denaturation for 5 min; 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1.5 min, 72 °C for 5 min, 30 cycles. PCR amplified SpPCS After the gene, it was connected to the sequencing carrier PMD19-T Simple plasmid by T-A cloning, and the correct transformant was picked, sequenced, and compared correctly, and the expression gene was obtained SpPCS The intermediate plasmid pMD19-T- SpPCS .
Embodiment 2
[0054] This example illustrates the construction of an expression gene SpPCS The recombinant plasmid pBBR1MCS-5- SpPCS method, see the specific construction method figure 2 . The process includes:
[0055] 1. Contains genes SpPCS The recombinant plasmid pBBR1MCS-5- SpPCS build,
[0056] (1) Synthesis with Sal1 The upstream primer of the restriction site and the downstream primer of the EcoR1 restriction site:
[0057] Primer3 upstream primer:
[0058] 5'-GCG GTC GAC ATGAACATTGTTAAACGAGCA -3';
[0059] Primer4 downstream primer:
[0060] 5'- GGG GATATC TCACGTATTTTTACAGCA-3'.
[0061] (2) with PMD19-T- SpPCS As a template, the target gene fragment was amplified by PCR. The reaction conditions were as follows: PCR reaction conditions were: 94°C pre-denaturation for 5 minutes; 94°C for 30 s, 55°C for 30 s, 72°C for 1.5 min, 72°C for 5 min, 30 cycles. Purified and amplified with enzyme cleavage site SpPCS After the gene, it was ligated with the pBBR1MCS...
Embodiment 3
[0063] This example illustrates that the constructed recombinant plasmid pBBR1MCS-5- SpPCS Electroporation transformation is introduced into the competent cells of Pseudomonas putida KT2440, and the positive transformant KT2440-SpPCS is obtained by screening with 50 μg / mL gentamicin.
[0064] (1) Preparation of KT2440 competent cells: Activate the KT2440 strain on the plate; pick a single colony after 20 hours and inoculate it in 5 mL LB seed solution; transfer it to 100 mL LB culture solution after 12 hours according to the inoculum amount of 1%; When OD600=0.6~0.75, immediately put it on ice for 20 minutes; 4°C, 5000 r / min, centrifuge for 10 minutes to collect the bacteria, wash the bacteria with HEPES buffer (3 mM, pH=7.0) 3 times; add 500 μL Resuspend in HEPES buffer, add 500 μL of 20% glycerol, aliquot each 50 μL for one electroporation.
[0065] (2) Electric transformation conditions: take 50 ng of the recombinant plasmid, and use the following electroporation transfor...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 