Mutated cephalosporin C acylase

A technology of cephalosporin and acylase, which is applied in the direction of bacteria, hydrolase, biochemical equipment and methods, etc., can solve the problems of low enzyme activity and low substrate conversion rate, and achieve high expression activity and product tolerance Enhanced, efficient catalytic effect

Active Publication Date: 2014-08-06
TSINGHUA UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, in the research on the transformation of CPC acylase, low enzyme activity, low substrate conversion rate and serious product inhibition are the main factors restricting the industrialization of CPC acylase to catalyze the production of 7-ACA from CPC

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutated cephalosporin C acylase
  • Mutated cephalosporin C acylase
  • Mutated cephalosporin C acylase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Gene Mutation of Mutant Cephalosporin C Acylase CPCacy-D2

[0026] Starting from the gene sequence corresponding to the original CPC acylase SEQ ID NO: 1 (SEQ ID NO: 4 described in Chinese invention patent ZL200810102219.7), using pUC18-acy (Chinese invention patent ZL 200810102219.7) as a template, using Construction of Mutant Cephalosporin C Acylase CPCacy by Polymerase Chain Reaction (PCR) Method M . According to the steps described in the TaKaRa MutanBEST kit, a pair of Up1-Down1 primers (Up1: GGCGGTGATGCCAGCGACGCA; Down1: TCCAGCCGTTGATGCATTACTGAAA) were used to reversely amplify the plasmid pUC18-acy to delete 227-228 at the C-terminus of the α subunit The two amino acid residues of Ala-Met.

[0027] The reaction system for PCR is: sterile water 37.7 μL, 10 × Pyrobest Buffer, 5 μL; dNTPs (each dNTP concentration 2.5 mM), 4 μL; upstream and downstream primers (concentration 20 μmolL -1 ), 1 μL each; plasmid template, 1 μL; Pyrobest DNA polymerase (5 UμL -1 ), 0....

Embodiment 2

[0031] Mutation of the improved mutant cephalosporin C acylase CPCacy-D4 gene and construction of its transformant

[0032]Other conditions are the same as in Example 1, but the PCR primers used are changed to Up2-Down2, wherein the gene sequence of Up2 is: GCATTACGTCCAGCCGTTGATGCAT; the gene sequence of Down2 is: AGGCGTGGAAGCGGAGCGTCTGGAG. The recombinant plasmid pUC18-CPCacy was obtained after PCR amplification and ligation M-D4 , a mutant CPC acylase gene carrying a deletion at positions 212-215 of Ala-Asp-Leu-Ala. The amino acid sequence of the encoded protein is SEQ ID NO: 3, which is the mutant CPCAcy-D4.

Embodiment 3

[0034] Expression vector pET28-CPCacy M and pMKC-CPCacy M Construction and transformant construction

[0035] (1) Plasmid pET28-CPCacy M-D2 Construction: the plasmid vector pUC18-acy obtained in Example 1 M-D2 and pET28a (Novagen Company) were cut with BamHI / HindIII double enzymes respectively. The volume of enzyme digestion reaction is 50 μL, the amount of plasmid is 17 μL, the amount of each enzyme is 1 μL, buffer solution is 5 μL, and it is made up to 50 μL with sterile water. React overnight at 37°C to obtain the restriction product CPC acylase gene and the linear plasmid backbone of pET28a. After the PCR product recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used to purify the digested product, the CPC acylase gene and the linearized plasmid backbone of pET28a were digested with T4 DNA ligase at a concentration ratio of 3:1 at 4°C. Ligation reaction, the connection reaction time is 14 h to 16 h. Transform the ligation reaction into the host s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a product-resistant inhibitory mutated cephalosporin C acylase, a gene carrier and a transformant of the enzyme, and application of the enzyme in one-step enzymatic production of 7-aminocephalosporanic acid, belonging to the technical field of enzyme engineering and biotechnology industry. The amino acid sequence of the enzyme is obtained by conducting deletion mutation on the amino acid sequence of cephalosporin C acylase coded by the gene sequence SEQ ID NO:1 to obtain enzyme CPCAcy-D2 and CPCAcy-D4. The amino acid sequences are shown as SEQ ID NO:2 and SEQ ID NO:3, respectively. The invention also discloses the gene carrier, the transformant, and the application of the enzyme. The enzyme has high expressing activity, and also the tolerance of the product is improved significantly, so that CPC is catalyzed efficiently to produce 7-ACA.

Description

technical field [0001] The invention belongs to the field of enzyme engineering and industrial biotechnology, and in particular relates to a product-inhibition-resistant mutant cephalosporin C acylase, a carrier of the enzyme gene, a transformant and its use in one-step enzymatic production of 7-aminocephalosporanic acid Applications. Background technique [0002] Cephalosporin C (CPC) acylase produced by microorganisms can efficiently catalyze the removal of the side chain of cephalosporin C to generate 7-aminocephalosporanic acid (7-ACA). Cephalosporins, like penicillin, are a family of β-lactam broad-spectrum antibiotics, which play a bactericidal role by interfering with the synthesis of bacterial cell walls and accelerating the destruction of cell walls. The use of cephalosporin C acylase produced by microorganisms to catalyze the production of 7-aminocephalosporanic acid has the advantages of simple process, safety, high efficiency, and low pollution, so it has gradua...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/80C12N15/55C12N15/63C12N1/21C12P35/02C12R1/19
Inventor于慧敏张婧王颖罗晖沈忠耀
OwnerTSINGHUA UNIV