Adsorbing material of hepatitis B antigen protein and preparation method of material

An antigenic protein, hepatitis B technology, applied in the field of medical biomaterials, can solve the problems of cumbersome and complicated antibody production, many steps in the preparation process, and dangerous biological safety, so as to reduce the risk of immune rejection, simple and safe synthesis, and simple operation Effect

Active Publication Date: 2015-06-10
WUHAN RUIFA MEDICAL DEVICES CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

They all use the immune binding reaction to adsorb hepatitis B virus particles, but their adsorption materials are based on antibody materials, and there are three shortcomings: 1) There is a biological safety risk of triggering allergic reactions, so the performance of the product is not good. Stable; 2) The production of antibodies is extremely cumbersome and complicated, and there are many steps in the preparation process, so the obtained adsorption material products have large differences between batches; 3) Simply using antibodies as the binding basis cannot deal with hepatitis B virus particles with "immune escape" properties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adsorbing material of hepatitis B antigen protein and preparation method of material
  • Adsorbing material of hepatitis B antigen protein and preparation method of material
  • Adsorbing material of hepatitis B antigen protein and preparation method of material

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Expression and purification of human recombinant receptor protein

[0034] a) download the data NM_003049 from GenBank, and obtain the coding sequence of the NTCP polypeptide therefrom;

[0035] b) genetically improve the obtained coding sequence to obtain the corresponding prokaryotic expression sequence, the sequence is as follows:

[0036] 5’atggaagcacacaacgcgtctgcccctttcaacttcactctgccaccgaactttggcaaacgtccaacggacctggcactgtctgtaatcctggtattcatgctgttcttcattatgctgtctctgggttgcactatggagttctccaaaatcaaagcacatctgtggaaaccgaagggtctggcgattgcgctggtagcacagtatggcatcatgccactgactgctttcgttctgggtaaagtattccgtctgaaaaacattgaagcactggcgatcctggtatgtggttgctctccgggcggtaacctgtccaacgtgttctctctggccatgaaaggcgacatgaatctgagcatcgttatgactacttgcagcaccttttgcgctctgggcatgatgccgctgctgctgtacatctattctcgcggcatctacgatggtgatctgaaagacaaggttccgtataaaggtatcgtgatctccctggttctggtgctgatcccgtgcaccatcggtatcgttctgaagagcaaacgtccgcaatacatgcgctacgttattaaaggcggcatgatcattatcctgctgtgctctgtggcggtcaccgtcctgtctgccatcaac...

Embodiment 2

[0054] Example 2: Preparation of Adsorbent Material and Immobilization of Receptor Protein

[0055] Epoxy-active agarose gel (Sepharose CL-4B) was prepared using ethylene glycol diglycidyl ether as a coupling agent.

[0056] Add 600ml of agarose gel and 400ml of 2mol / L NaOH aqueous solution into a 2L reactor, mix well, add 400ml of ethylene glycol bisglycidyl ether, place in a constant temperature shaker, and react at 37°C for 1 hour. After the reaction was completed, the gel was filtered and rinsed with a large amount of distilled water until pH=7. Store the activated medium at 4°C for later use. The number of epoxy groups in the gel was detected by the sodium thiosulfate method, and it was measured that there were at least 40 μmol of active groups per milliliter.

[0057] Add 200ml of epoxy-activated agarose gel (Sepharose CL-4B) synthesized in this example, 600ml of 0.3mol / L boric acid buffer solution into a 2L reactor, control the pH value within the range of 8.0 to 10.0...

Embodiment 3

[0058] Example 3: Using commercialized hepatitis B antigen as the adsorption object to detect the performance of the adsorption material

[0059] Inject 5 ml of the adsorption material obtained in Example 2 into a 500 ml Erlenmeyer flask, and add 100 ml of the PBS solution of hepatitis B antigen. React in a constant temperature shaker, shake at a low speed of 37°C for 90 minutes, use the ultraviolet method to detect the concentration of hepatitis B toxic protein, and take the ratio to determine the adsorption efficiency. The results are shown in Table 3-1

[0060] Adsorption efficiency of adsorption material to purified antigen under table 3-1 shaking table condition

[0061]

[0062] Inject 5ml of the adsorbent material obtained in Example 2 onto the filter membrane of the chromatography column, and communicate with it with a flexible pipe. Recover the filtered hepatitis B antigen solution with a clean triangular flask. The filtered solution was re-injected into the chr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific adsorbing material for removing hepatitis B virus protein in blood plasma, and a preparation method of the adsorbing material, and discloses a high polymer material which is prepared by coupling sepharose gel with gene-modified sodion taurocholic acid cotransporting polypeptide. The preparation method of the material comprises the steps of reacting the sepharose gel, which is taken as a carrier matrix, with a bi-glycidyl ether coupling reagent to obtain an active carrier, and subsequently, conducting coupling reaction on the active carrier with the sodion taurocholic acid cotransporting polypeptide which is fused with polypeptide tags. The synthesis method of the material is simple and convenient, the process route is short and the preparation is safe; and the material has the characteristics of strong specificity, high adsorption rate to the hepatitis B virus protein, good regenerability, harmlessness and no heat source reaction, and can be applied to clinical adsorption treatment to eliminate the hepatitis B virus protein in blood plasma in a specificity mode.

Description

technical field [0001] The invention belongs to medical biological materials, and specifically relates to an adsorption material for hepatitis B antigen protein used for blood purification and a preparation method thereof. Background technique [0002] Hepatitis B virus infection is a common disease that threatens human health. It spreads widely and is very harmful. It is a disease that seriously endangers the health of our people. my country is a high-incidence area of ​​hepatitis B, the total infection rate of the population is as high as 60%, and the surface antigen carriers that constitute the source of hepatitis B infection are about 10%. There are more than 130 million carriers of hepatitis B surface antigen (HBsAg) in China, about 10% of which eventually transform into various chronic hepatitis, and finally into liver cirrhosis or even liver cancer, which brings a huge economic burden to the society. At present, the main anti-HBV drugs are: interferon, lamivudine, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): B01J20/26B01J20/30B01D15/00C07K17/10
Inventor王业富森林韩振伟
OwnerWUHAN RUIFA MEDICAL DEVICES CO LTD