Method for synthesizing bilirubin by utilizing immobilized enzyme

A technology for immobilizing enzymes and bilirubin, applied in the field of molecular biology and biology, can solve the problems of high price and high cost of bilirubin

Active Publication Date: 2014-04-16
BONTAC BIO ENG SHENZHEN
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, bilirubin comes from bile, and one kilogram of bilirubin needs about 50,000 pig galls, so the cost of bilirubin is relatively high, so the price is also high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing bilirubin by utilizing immobilized enzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1: Amplification and cloning of heme oxygenase coding gene

[0023] Primers HO-F: 5'AACATATGTCAATAATTAATAATTATAT3' and HO-R: 5'AAGGCGCGCCCTATTTAAATCTATCAATTCT3' were designed according to the gene sequence of the gene bank (GenBank NC_004557). The gene encoding heme oxygenase was amplified from Clostridium tetani E88 using the primer pair HO-F and HO-R.

[0024] Amplification conditions are: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH 4 ) 2 SO 4 , 2mM MgSO 4 , 0.1%Triton X-100, 50μM dATP, 50μM dTTP, 50μM dCTP, 50μM dGTP, 400nM primer HO-F, 400nM primer HO-R, 1.0U Pfu DNA polymerase (Promega, USA), pick a little with an inoculation loop Clostridium tetani E88 cells, and then adjust the reaction volume to 50 μl with sterile water.

[0025] The PCR amplification reaction program was: 95°C for 3 minutes, 35 cycles: 95°C for 50 seconds, 50°C for 30 seconds, 72°C for 1 minute, and finally 72°C for 10 minutes. The amplified product was digested with restriction ...

Embodiment 2

[0026] Example 2: Amplification and cloning of the gene encoding biliverdin reductase

[0027] Primers BR-F: 5'AACATATGTCTGAAAATTTTGCAGTT3' and BR-R: 5'AAGGCGCGCCCTAATTTTCAACCTTATATCCA3' were designed according to the gene sequence of the gene bank (GenBank NC_000911). The gene encoding biliverdin reductase was amplified from Synechocystis sp. PCC6803 with primer pair BR-F and BR-R.

[0028] Amplification conditions are: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH 4 ) 2 SO 4 , 2mM MgSO 4 , 0.1%Triton X-100, 50μM dATP, 50μM dTTP, 50μM dCTP, 50μM dGTP, 400nM primer BR-F, 400nM primer BR-R, 1.0U Pfu DNA polymerase (Promega, USA), pick a little with the inoculation loop Synechocystis sp. PCC6803 cells, and then adjust the reaction volume to 50 μl with sterile water.

[0029] The PCR amplification reaction program was: 95°C for 3 minutes, 35 cycles: 95°C for 50 seconds, 50°C for 30 seconds, 72°C for 1 minute, and finally 72°C for 10 minutes. The amplified product was digested w...

Embodiment 3

[0030] Embodiment 3: the extraction of heme oxygenase

[0031] The extraction and purification of heme oxygenase mainly refer to Hong-Bo Hu, et al. Bioprocess Biosyst Eng. 2007, 30:87–90. The specific process is as follows:

[0032]The plasmid pRSET-HO containing the heme oxygenase gene was transformed into a competent bacterial cell E. coli HB101, and cultured on a Luria broth (LB) plate (containing 100 mg / L kanamycin) at 37° C. for 24 hours. Inoculate a single clone in 5 ml LB liquid medium (containing 100 mg / L kanamycin) and culture at 30° C. for 20-24 hours. The cells were collected by centrifugation and suspended in 1 ml of 100 mM Tris-HCl buffer (pH 7.5). Bacterial cells are then lysed by sonication. Centrifuge (10°C, 17,800g, 10 minutes) and collect the supernatant, which is the crude protein extract (or crude extract).

[0033] figure 1 A shows the results of polyacrylamide gel electrophoresis of crude recombinant heme oxygenase protein, showing that heme oxygenas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of bilirubin production methods and discloses a method for synthesizing bilirubin by utilizing an immobilized enzyme. The method comprises the following steps of: a) respectively cloning haem oxygenase genes and biliverdin reductase genes; b) respectively expressing the recombinant haem oxygenase and biliverdin reductase in escherichia coli; c) extracting a crude extract or pure enzyme of haem oxygenase and a crude extract or pure enzyme of biliverdin reductase; d) immobilizing the crude extract or pure enzyme of haem oxygenase and the crude extract or pure enzyme of biliverdin reductase; and e) preparing bilirubin in the assistance of an oxidized coenzyme II by catalyzing with the immobilized haem oxygenase and the immobilized biliverdin reductase and taking haem and oxygen as substrates.

Description

technical field [0001] The invention relates to the fields of molecular biology and biotechnology, in particular to a method for synthesizing bilirubin by immobilized enzymes. Background technique: [0002] Bilirubin is the main pigment in human bile and is orange-yellow. Bilirubin has a variety of pharmacological effects and is the main raw material for the manufacture of artificial bezoar. Pharmacological experiments have proved that it has a good inhibitory effect on W256 tumor; its inactivation rate and inhibition index of Japanese encephalitis virus are 1 to 1.5 times higher than that of deoxycholic acid and cholic acid; it is also an effective hepatic agent. Drugs for the treatment of diseases can proliferate new cells without destroying liver tissue, and can treat diseases such as serum hepatitis and cirrhosis. In addition, bilirubin has sedative, sedative, antipyretic, antihypertensive and other effects. It is mainly used in the raw materials of artificial bezoar,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P17/16
Inventor张琦
OwnerBONTAC BIO ENG SHENZHEN