Method for synthesizing bilirubin by utilizing immobilized enzyme
A technology for immobilizing enzymes and bilirubin, applied in the field of molecular biology and biology, can solve the problems of high price and high cost of bilirubin
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Embodiment 1: Amplification and cloning of heme oxygenase coding gene
[0023] Primers HO-F: 5'AACATATGTCAATAATTAATAATTATAT3' and HO-R: 5'AAGGCGCGCCCTATTTAAATCTATCAATTCT3' were designed according to the gene sequence of the gene bank (GenBank NC_004557). The gene encoding heme oxygenase was amplified from Clostridium tetani E88 using the primer pair HO-F and HO-R.
[0024] Amplification conditions are: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH 4 ) 2 SO 4 , 2mM MgSO 4 , 0.1%Triton X-100, 50μM dATP, 50μM dTTP, 50μM dCTP, 50μM dGTP, 400nM primer HO-F, 400nM primer HO-R, 1.0U Pfu DNA polymerase (Promega, USA), pick a little with an inoculation loop Clostridium tetani E88 cells, and then adjust the reaction volume to 50 μl with sterile water.
[0025] The PCR amplification reaction program was: 95°C for 3 minutes, 35 cycles: 95°C for 50 seconds, 50°C for 30 seconds, 72°C for 1 minute, and finally 72°C for 10 minutes. The amplified product was digested with restriction ...
Embodiment 2
[0026] Example 2: Amplification and cloning of the gene encoding biliverdin reductase
[0027] Primers BR-F: 5'AACATATGTCTGAAAATTTTGCAGTT3' and BR-R: 5'AAGGCGCGCCCTAATTTTCAACCTTATATCCA3' were designed according to the gene sequence of the gene bank (GenBank NC_000911). The gene encoding biliverdin reductase was amplified from Synechocystis sp. PCC6803 with primer pair BR-F and BR-R.
[0028] Amplification conditions are: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH 4 ) 2 SO 4 , 2mM MgSO 4 , 0.1%Triton X-100, 50μM dATP, 50μM dTTP, 50μM dCTP, 50μM dGTP, 400nM primer BR-F, 400nM primer BR-R, 1.0U Pfu DNA polymerase (Promega, USA), pick a little with the inoculation loop Synechocystis sp. PCC6803 cells, and then adjust the reaction volume to 50 μl with sterile water.
[0029] The PCR amplification reaction program was: 95°C for 3 minutes, 35 cycles: 95°C for 50 seconds, 50°C for 30 seconds, 72°C for 1 minute, and finally 72°C for 10 minutes. The amplified product was digested w...
Embodiment 3
[0030] Embodiment 3: the extraction of heme oxygenase
[0031] The extraction and purification of heme oxygenase mainly refer to Hong-Bo Hu, et al. Bioprocess Biosyst Eng. 2007, 30:87–90. The specific process is as follows:
[0032]The plasmid pRSET-HO containing the heme oxygenase gene was transformed into a competent bacterial cell E. coli HB101, and cultured on a Luria broth (LB) plate (containing 100 mg / L kanamycin) at 37° C. for 24 hours. Inoculate a single clone in 5 ml LB liquid medium (containing 100 mg / L kanamycin) and culture at 30° C. for 20-24 hours. The cells were collected by centrifugation and suspended in 1 ml of 100 mM Tris-HCl buffer (pH 7.5). Bacterial cells are then lysed by sonication. Centrifuge (10°C, 17,800g, 10 minutes) and collect the supernatant, which is the crude protein extract (or crude extract).
[0033] figure 1 A shows the results of polyacrylamide gel electrophoresis of crude recombinant heme oxygenase protein, showing that heme oxygenas...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com