Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Magnaporthe grisea MoLON1 gene function and application thereof

A rice blast fungus and gene technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as non-infectious growth, and achieve the effect of reducing the number of disease cycles and weakening rice blast.

Inactive Publication Date: 2013-08-21
JILIN UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2009, Chi et al. reported that the knockout of a DES1 gene encoding an unknown protein had no significant effect on the development and infection of Magnaporthe grisea, but the ΔDES1 mutant could not grow invasively in the host after infecting rice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Magnaporthe grisea MoLON1 gene function and application thereof
  • Magnaporthe grisea MoLON1 gene function and application thereof
  • Magnaporthe grisea MoLON1 gene function and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1, correlation analysis of MoLON1 gene

[0044] The MoLON1 gene is located on chromosome 1 of Magnaporthe oryzae, with a full length of 3434bp, containing 1 intron and 2 exons (see figure 1 ). The amino acid sequence of the MoLON1 gene was compared and analyzed (http: / / blast.ncbi.nlm.nih.gov / ), and it was found that the MoLON1 gene is ubiquitous in a variety of organisms and has a high homology (see figure 2 ).

Embodiment 2

[0045] Example 2, knockout analysis of MoLON1 gene

[0046] 1) Construction of knockout vector

[0047] Gene knockout adopts the method of homologous recombination, and replaces part of the coding region of the MoLON1 gene in the wild-type strain MoJJ88 with the hygromycin phosphotransferase gene. For the specific construction strategy, see image 3 . Using the wild-type strain MoJJ88 genomic DNA as a template, primers pX-up1 (5'GCTCTAGAATGTACCTAGGATGG 3', 5' end containing Xba I restriction site) and pX-up2 (5'CGGGATCCTTGATGGTTATTGCT 3', 5' end containing BamH I restriction site) as the left arm, using primers pX-down1 (5'GGGGTACCACGATGCCATTGAGGAGC 3', the 5' end contains Kpn I restriction site) and pX-down2 (5'GGAATTCGGAAAGACGAGCCCGAAG 3', 5' The fragment amplified from the 'end contains the EcoR I restriction site) was used as the right arm. After digestion, they were respectively connected to both sides of the hygromycin phosphotransferase gene in the vector pXEH accord...

Embodiment 3

[0054] Embodiment 3, vegetative growth status analysis

[0055] The solid CM plate culture method was adopted. The bacterial block was inoculated on a solid CM medium plate, cultured in the dark at 25°C for 8 days, and photographed for observation. Compared with the wild type, the colony growth rate of the mutant was slowed down, and the number of aerial hyphae was significantly reduced (see Figure 4 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The Magnaporthe grisea MoLON1 gene function and application thereof belong to the field of bioengineering technology, and the invention relates to the function in the pathogenic processes of Magnaporthe grisea MoLON1 gene and purification and purpose of coding proteins thereof. The gene and the ATP-dependent protease Lon1 in yeast, Escherichia coli and other organisms have high homology, and the gene codes 1119 amino acids and contains one intron and two exons. The knockout of MoLON1 gene leads to minimizing of Magnaporthe grisea aerial hyphae quantity, reduction of conidiospore output, basic deprivation of expansion capability of infective hyphae in the paddy rice leaf cells, and improvement of sensitivity to a plurality of adverse conditions; the invention also relates to expression and purification of proteins coded by the MoLON1 gene, and gene can be used as a candidate target for designing and screening anti-Magnaporthe grisea novel medicament.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to the application of a gene and its encoded protein in the field of plant disease prevention and control, which affect the production and pathogenicity of blast fungus conidia, in the prevention and control of plant diseases, and as a drug target for the control of blast fungus. application. Background technique [0002] Rice blast caused by Magnaporthe oryzae is an important disease affecting rice production in the world, and has become one of the three major rice diseases in my country. The rice yield loss caused by blast fungus infection is about 10% to 30% every year, and the severely diseased fields may even fail to harvest. From 2001 to 2005, 5.7 million hectares of rice in my country were destroyed by Magnaporthe oryzae (Wilson and Talbot, 2009). Due to the economic importance of rice blast and the ease of culture and genetics of rice blast, the pathogeni...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C07K14/37C12N15/63C12N15/80C12N1/15A01H5/00A01N61/00A01P3/00C12Q1/68G01N33/68C12R1/645
Inventor 贾保磊李健王煜涵刘金亮张世宏潘洪玉
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com