Supercharge Your Innovation With Domain-Expert AI Agents!

Bluetongue virus serum 1 (BTV1) VP2 protein monoclonal antibody (BTV1-3E8), B-cell epitope polypeptide identified by BTV1-3E8 and application of BTV1-3E8

A bluetongue virus, monoclonal antibody technology, applied in antiviral immunoglobulins, antiviral agents, antibodies, etc., can solve the problem of lack of serotype detection methods and reagents

Inactive Publication Date: 2013-09-18
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the research on this disease in our country started relatively late. At present, there are only reports on the preparation of BTV group-specific Mab, and there is a lack of reagents needed to establish a serotype detection method. Therefore, we urgently need to strengthen research on this disease and make technical reserves

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bluetongue virus serum 1 (BTV1) VP2 protein monoclonal antibody (BTV1-3E8), B-cell epitope polypeptide identified by BTV1-3E8 and application of BTV1-3E8
  • Bluetongue virus serum 1 (BTV1) VP2 protein monoclonal antibody (BTV1-3E8), B-cell epitope polypeptide identified by BTV1-3E8 and application of BTV1-3E8
  • Bluetongue virus serum 1 (BTV1) VP2 protein monoclonal antibody (BTV1-3E8), B-cell epitope polypeptide identified by BTV1-3E8 and application of BTV1-3E8

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1B

[0040] Prokaryotic expression and purification of embodiment 1BTV1-VP2 protein

[0041] 1. Primer Design

[0042] According to the BTV1VP2 gene sequence registered in Genbank (accession number: JN848760.1), design PCR amplification primers, the sequence is as follows:

[0043] BTV1-VP2-BamHI-1-23F: 5'CTGGATCCATGGATGAACTAGGCATCCCAGT3'

[0044] BTV1-VP2-Hind-2886-2865R: 5'GCCAAGCTTTCATACGTTGAGAAGTTTTGTC3'

[0045] The underlined part is the introduced restriction site of BamH I and Hind III, and the length of the amplified product is expected to be 2886bp.

[0046] 2. Extraction and reverse transcription of BTV1 viral RNA

[0047] Viral genomic RNA was extracted from BHK-21 cells infected with BTV1 by Trizol method as a template, and viral cDNA was synthesized by reverse transcription with BTV1-VP2-Hind-2886-2865R primers.

[0048] RNA extraction step by Trizol method: Harvest BHK-21 cells infected with BTV1 1-5×10 7 Add 1mL Trizol and mix well, let stand at room temperatur...

Embodiment 2

[0078] The preparation of embodiment 2 monoclonal antibody

[0079] 1. Mice Immunization

[0080] Immunize five 6-week-old female BALB / c mice with the purified prokaryotic recombinant VP2 protein, and immunize three times with two weeks between each immunization. Firstly, mix the recombinant VP2 protein with an equal volume of Freund's complete adjuvant Emulsification, second immunization and third immunization The recombinant NS1 protein was mixed and emulsified with an equal volume of Freund's incomplete adjuvant, the immunization dose was 50 μg per mouse, and the immunization route was intraperitoneal immunization.

[0081] One week after the second and third immunizations, blood was collected from the tail of the mice, the serum was separated (4°C, 10,000 rpm, 10 min), and the antibody level was detected by indirect ELISA. Three days before cell fusion, BALB / c mice with good immune effect were boosted again.

[0082] 2. Cell Fusion

[0083] Feeder cells were prepared 1 ...

Embodiment 3

[0089] Identification of embodiment 3Mab

[0090] 1. Subclass identification of Mab

[0091] SBA Clonotyping TM System / HRP Antibody Subclass Identification Kit Operating Instructions The Mab obtained in Example 1 was used for subclass identification.

[0092] The result shows that the heavy chain of Mab BTV1-3E8 of the present invention is IgG 1 , the light chain is a κ chain.

[0093] 2. Western blot identification

[0094] The cell pellet after the centrifugation harvested the BTV1 virus supernatant and the BHK-21 cell pellet were subjected to SDS-PAGE electrophoresis and then electrotransfer. The electrotransfer condition was 17V for 30min. Put the transferred nitrocellulose membrane into PBST blocking solution containing 50g / L skimmed milk powder to block overnight at 4°C; put the blocked nitrocellulose membrane into the supernatant of positive hybridoma culture medium for 1h at room temperature, (pH7.4 PBST buffer containing 0.5mL / L Tween-20) washed 3 times, then re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bluetongue virus serum 1 (BTV1) VP2 protein monoclonal antibody (BTV1-3E8), a B-cell epitope polypeptide identified by the BTV1-3E8 and application of the BTV1-3E8, belonging to the field of the prevention and treatment of bluetongue. The invention further relates to a hybridoma cell strain which secretes the monoclonal antibody. The BTV1-VP2 protein monoclonal antibody secreted by the hybridoma cell strain disclosed by the invention is named BTV1-3E8. Furthermore, the BTV1-VP2 protein B-cell epitope polypeptide, namely <465>YGQMINEMI<473>, identified by the antibody is appraised by using truncated antigen expression oligopeptides and a peptide scanning technology, and shown by sequence alignment results, the epitope polypeptide is a unique and conservative B-cell epitope polypeptide of BTV1. Shown by immunofluorescence experiment results, the BTV1-3E8 can be subjected to specific reaction with the BTV1 and does not react with BTV2 to BTV24. Thus, the monoclonal antibody BTV1-3E8 can be applied to the research and application of BTV1 specific diagnosis.

Description

technical field [0001] The present invention relates to a hybridoma cell strain and its secreted monoclonal antibody (Monoclonal antibody, Mab), in particular to a hybridoma cell strain secreting anti-Bluetongue virus serotype 1 (Bluetongue virus1, BTV1) VP2 protein Mab and the Mab secreted by it; the present invention also relates to a B cell epitope polypeptide, especially to the BTV1VP2 protein B cell epitope polypeptide recognized by the above-mentioned Mab; the present invention also relates to the above-mentioned hybridoma cell line, Mab and B cell epitope in The application in the preparation of drugs for diagnosis or prevention of BTV belongs to the field of prevention and treatment of bluetongue (Bluetongue, BT). Background technique [0002] Bluetongue (Bluetongue, BT) is an acute non-contact infectious disease caused by Bluetongue virus (BTV) and is transmitted by insects such as Culicoides. It is characterized by fever, leukopenia, buccal mucosa and gastrointesti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/20C07K16/10C07K7/06G01N33/577G01N33/569A61K39/42A61P31/14G01N33/68
Inventor 吴东来徐青元刘霓红杨涛
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More