Preparation method of HRPII protein monoclonal antibody of plasmodium falciparum
A technology of Plasmodium falciparum and monoclonal antibody, which is applied in the fields of botanical equipment and methods, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of false positive test results, difficulty in preparing monoclonal antibodies, and difficulty in expression, etc. To achieve the effect of high specificity, enhanced stimulation, and improved expression level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0006] Example 1: Selection of dominant antigenic epitopes of Plasmodium falciparum HRPII.
[0007] Using the Plasmodium falciparum HRPII protein as the target antigen, the hydrophilicity and antigenicity of its amino acid sequence were analyzed using the biological software DNAssist2.0, and two dominant antigenic epitopes, A and B, were selected. The results of sequence comparison showed that the selected two dominant antigenic epitopes A and B had high sequence specificity and no obvious homology with other protein sequences.
[0008] A: LeuAsnLeuAsnLysArgLeuLeuHisGluThrGlnAlaHisValAspAspAlaHisHisAlaHisHisValAlaAspAlaHisHisAlaHis
[0009] B: AspAlaArgHisAlaThrAspAlaHisHisAlaAlaAspAlaHisHisAlaThrAspAlaHis.
Embodiment 2
[0010] Example 2: Concatenation of HRPII dominant epitopes of Plasmodium falciparum.
[0011] In order to enhance the stimulation of the target antigen epitope on the mouse immune system, the two dominant antigen epitope sequences of Plasmodium falciparum HRPII protein A and B were respectively repeated and then connected by a flexible fragment (four consecutive glycines) to obtain recombinant protein C amino acids sequence, the specific sequence is as follows:
[0012] LeuAsnLeuAsnLysArgLeuLeuHisGluThrGlnAlaHisValAspAspAlaHisHisAlaHisHisValAlaAspAlaHisHisAlaHisLeuAsnLeuAsnLysArgLeuLeuHisGluThrGlnAlaHisValAspAspAlaHisHisAlaHisHisValAlaAspAlaHisHisAlaHisGlyGlyGlyGlyAspAlaArgHisAlaThrAspAlaHisHisAlaAlaAspAlaHisHisAlaThrAspAlaHisAspAlaArgHisAlaThrAspAlaHisHisAlaAlaAspAlaHisHisAlaThrAspAlaHis。
Embodiment 3
[0013] Example 3: Optimizing the nucleotide sequence encoding recombinant protein C.
[0014] In order to increase the expression of recombinant protein C, on the premise that the amino acid sequence of recombinant protein C remains unchanged, the nucleotide sequence encoding recombinant protein C is optimized by using the most codon of Escherichia coli. The optimized nucleotide sequence is as follows:
[0015] CTGAACCTGAACAAACGCCTGCTGCATGAAACCCAGGCCCATGTGGATGATGCCCATCATGCCCATCATGTGGCCGATGCCCATCATGCCCATCTGAACCTGAACAAACGCCTGCTGCATGAAACCCAGGCCCATGTGGATGATGCCCATCATGCCCATCATGTGGCCGATGCCCATCATGCCCATGGCGGCGGCGGCGATGCCCGCCATGCCACCGATGCCCATCATGCCGCCGATGCCCATCATGCCACCGATGCCCATGATGCCCGCCATGCCACCGATGCCCATCATGCCGCCGATGCCCATCATGCCACCGATGCCCAT
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
