Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting nucleic acid by combining template amplification and signal amplification

A signal amplification, nucleic acid technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of high detection cost, false positives, product contamination, etc., to achieve high sensitivity, sensitive detection, and avoid pollution.

Active Publication Date: 2013-10-23
武汉中帜生物科技股份有限公司
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, nucleic acid detection has been an important means for the detection of various pathogens, among which the PCR method is the most commonly used, yet some problems are often encountered when using PCR-based molecular detection methods, such as: (1) need to amplify a single pathogen respectively, for multiple The detection efficiency of pathogens is not high, and when there is an epidemic of infectious diseases, it is necessary to quickly detect pathogens in a large number of samples; (2) contamination of previous amplification products will lead to false positives; (3) real-time PCR technology requires expensive fluorescent probes and expensive Advanced detection equipment, high detection cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting nucleic acid by combining template amplification and signal amplification
  • Method for detecting nucleic acid by combining template amplification and signal amplification
  • Method for detecting nucleic acid by combining template amplification and signal amplification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1. Detection of Human Respiratory Syncytial Virus RSV

[0037] 1. Design and synthesis of capture molecules, capture bridge molecules, amplification bridge molecules, marker molecules and carrier molecules:

[0038] Capture molecule: GTTGGGCTACGACTTAGAGGCC (SEQ ID No1)

[0039] Marker molecule 1: Biotin-ACCCGATGGATAGGTCGGTGAA (SEQ ID No2)

[0040] Marker molecule 2: Biotin-TAAGCATCGTGCCCTTTCGCAG (SEQ ID No3)

[0041] Marker molecule 3: biotin-ACCACGTTCGCGTTCTCACATG (SEQ ID No4)

[0042] Carrier molecule:

[0043]AGAAGGCGTCCGTCTTTGAGGCTTCACCGACCTATCCATCGGGTCTGCGAAAGGGCACGATGCTTACATGTGAGAACGCGAACGTGGT (SEQ ID No. 5)

[0044] According to the F gene sequence of RSV in the genebank, the sequences of primers, capture bridge molecules and amplification bridge molecules were designed as follows:

[0045] Primer 1: GTGGTAATTGTACTACATATGCTAAG (SEQ ID No 6)

[0046] Primer 2: TAATACGACTCACTATAGGGAGAATGCAGGTGTAACTACACCTGTAAG (SEQ ID No 7)

[0047] Capture bridge mol...

Embodiment 2

[0069] Embodiment 2: Eight items of respiratory pathogen nucleic acid detection

[0070] Simultaneously detect eight respiratory pathogens in the samples to be tested (nasopharyngeal swabs, etc.), including influenza A virus (FLUA), influenza B virus (FLUB), human parainfluenza virus (PIV), adenovirus (AdV), human Rhinovirus (HRV), Respiratory Syncytial Virus (RSV), Mycoplasma pneumoniae (MP), Chlamydia pneumoniae (Cpn). The amplification buffer contains primers for 8 kinds of pathogens, which can simultaneously amplify 8 kinds of pathogens that may exist in a sample through one reaction. During the detection, the sample is divided into 8 parts for hybridization, and the corresponding capture of a single pathogen is used respectively. The bridge molecule and the amplified bridge molecule are hybridized and identified, and finally realize the high-throughput detection of pathogens in a single sample.

[0071] 1. Design and synthesis of primers, capture molecules, capture bridg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting nucleic acid by combining template amplification and signal amplification. The method comprise the steps of obtaining first amplification of a nucleic acid signal by template linear amplification of a to-be-detected nucleic acid molecules; adding a RNA product obtained by the amplification into a solid phase together with amplification bridge molecules and capture bridge molecules to carry out hybridization; capturing the RNA product on the solid phase; hybrid identifying one ends of the amplification bridge molecule with the RNA product; combining the other ends of the amplification bridge molecule with the amplification bridge molecules added in the following step; combining a plurality of biotin molecules connected on the amplification bridge molecules with markers such as horse radish peroxidase; and finally realizing dual amplification process of the acid signal. The method for detecting the nucleic acid has extremely high sensitivity.

Description

technical field [0001] The invention relates to a method for detecting nucleic acid in combination with template amplification and signal amplification, which belongs to the field of biological detection. Background technique [0002] Nucleic acid detection is a general term for a series of technologies that directly detect nucleic acids of pathogens, and can detect target nucleic acids through blood, other body fluids or cells. Compared with conventional serological testing, nucleic acid detection technology has higher sensitivity and is an important supplement to immunological detection methods. It has considerable advantages in shortening the detection window period and improving the detection rate of pathogens. [0003] At present, nucleic acid detection has been an important means for the detection of various pathogens, among which the PCR method is the most commonly used, yet some problems are often encountered when using PCR-based molecular detection methods, such as:...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 李先强姜昕
Owner 武汉中帜生物科技股份有限公司