Leifsonia xyli HSO904-based short chain dehydrogenase, and encoding gene, carrier, engineering bacteria and application thereof

A technology of short-chain dehydrogenase and Reflutonella, which is applied in the field of short-chain dehydrogenase, can solve the problems of low activity of short-chain dehydrogenase/reductase, limitation of large-scale preparation and application, etc.

Active Publication Date: 2013-12-04
艾吉泰康(嘉兴)生物科技有限公司
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the activity of wild-type short-chain dehydrogenase/reductase is low, which limits its large-scale preparation and application. Therefore, th...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leifsonia xyli HSO904-based short chain dehydrogenase, and encoding gene, carrier, engineering bacteria and application thereof
  • Leifsonia xyli HSO904-based short chain dehydrogenase, and encoding gene, carrier, engineering bacteria and application thereof
  • Leifsonia xyli HSO904-based short chain dehydrogenase, and encoding gene, carrier, engineering bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1: Derived from short-chain dehydrogenase, coding gene of Reflussonella

[0058] The total genomic DNA of the Leifsonia xyli HS0904 strain was extracted with a nucleic acid extraction kit (Axygen Co.) (this strain has been protected as a new strain in the Chinese invention patent ZL201010523043.X and preserved in the Chinese Typical Culture Collection Center, address: China, Wuhan, Wuhan University, collection number is CCTCC M2010241, storage date: September 21, 2010), using the genomic DNA as a template, primer 1 (ATGGCNCARTAYGAYGTNGC), primer 2 (YYAYTGNGCNGTRTAKCCYCC) under the effect of PCR amplification.

[0059] Addition amount of each component of the PCR reaction system (total volume 50 μL): Pfu DNA Polymerase mix 25 μL, cloning primer 1 and primer 2 each 3 μL (100 μM), genomic DNA 1 μL, nucleic acid-free water 18 μL. Biorad PCR instrument was used to amplify. The PCR reaction conditions were: pre-denaturation at 95°C for 5min, followed by temperatur...

Embodiment 2

[0060] Embodiment 2: Vector and recombinant genetically engineered bacteria

[0061] According to the analysis results of Example 1, expression primers 3 and 4 were designed, and Nco I and Hind III restriction enzyme sites were introduced into primers 3 and 4, respectively. In primer 3 ( CCATGG CGCAGTACGACGTGG, the underlined part is the Nco I restriction site, the italic part is the protected base) and primer 4 ( AAGCTT CTATTGTGCTGTGTAGCCTC, the underlined part is the Hind III restriction site, and the italic part is the protective base), and the high-fidelity Pyrobest DNA polymerase was used to amplify to obtain a 756bp short-chain dehydrogenase gene fragment (SEQ ID NO .1), after sequencing, use Nco I and Hind III restriction endonuclease to treat the amplified fragment, and use T4DNA ligase to treat the amplified fragment with the expression vector pET28a(+) treated with the same restriction endonuclease Connection, construction of expression vector pET28a(+)-SDR, p...

Embodiment 3

[0063] The recombinant Escherichia coli BL21 / pET28a(+)-SDR containing the expression recombinant plasmid pET28a(+)-SDR verified in Example 2 was used at 37°C and 200rpm in LB liquid medium containing 50 μg / mL kanamycin Shake culture for 12 hours, then inoculate into fresh LB liquid medium containing 50 μg / mL kanamycin with a volume concentration of 1% inoculum, and culture at 37°C and 200 rpm to the cell concentration OD 600 0.6-0.9, then add isopropyl-B-D-thiogalactopyranoside (IPTG) with a final concentration of 0.1mM to the culture medium, place at 30°C, 200rpm for 10h, centrifuge at 4°C, 10000rpm for 10min , collect the cells, wash the cells twice with normal saline, and collect the wet cells (that is, the whole cells of the recombinant bacteria).

[0064] (R)-3,5-bistrifluoromethylphenethanol is prepared by using wet bacteria as the enzyme source for transformation and using 3,5-bistrifluoromethylacetophenone as the substrate for the transformation reaction. Transformati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a leifsonia xyli HSO904-based short chain dehydrogenase, and an encoding gene, a carrier, engineering bacteria and application thereof. A gene of the leifsonia xyli HSO904-based short chain dehydrogenase has more than 90% of homology of a nucleotide sequence shown in SEQ ID NO. 1. A colon bacillus BL21/pET28a (+)-SDR prepared by the recombination of the short chain dehydrogenase is used as an enzyme source, 3, 5-bis-trifluoro methyl acetophenone, trifluoromethyl acetophenone, 4-hydroxyl-2-butanone, acetoacetic ester, 4-chloro ethyl acetoacetate, acetoacetic acid tert-butyl acetate and the like are used as substrates to prepare corresponding chiral compounds such as (R)-3, 5-bis-trifluoromethyl phenethyl alcohol, trifluoromethyl benzaldehyde ethanol, 2-hydroxyl-butyl alcohol, 3-hydroxy ethyl butyrate, 4-chloro-3-hydroxy ethyl butyrate and 3-hydroxy butyric acid tert-butyl acetate through a catalytic asymmetric reduction reaction.

Description

(1) Technical field [0001] The present invention relates to a short-chain dehydrogenase, in particular to a short-chain dehydrogenase gene, enzyme, recombinant expression vector, genetic engineering bacteria derived from Leifsonia xyli HS0904 strain, and its preparation Applications in chiral alcohols. (2) Background technology [0002] Short-chain dehydrogenases / reductases are widely found in plants, animals and microorganisms. Short-chain dehydrogenases / reductases (SDR) can catalyze such as 3,5-bistrifluoromethylacetophenone, p-trifluoromethylacetophenone, 4-hydroxy-2-butanol The corresponding (R)-3,5-bistrifluoromethylphenethyl alcohol, p-trifluoromethyl Phenylethyl alcohol, 2-hydroxy-butanol, ethyl 3-hydroxybutyrate, ethyl 4-chloro-3-hydroxybutyrate and tert-butyl 3-hydroxybutyrate and other chiral compounds, these chiral compounds are used in medicine, chemical industry and other fields play an important role. [0003] At present, short-chain dehydrogenase / reductase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/53C12N9/04C12N15/63C12N1/21C12N15/70C12P7/22C12P7/18C12P7/62C12R1/01
Inventor 王普王能强黄金
Owner 艾吉泰康(嘉兴)生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap