Unlock instant, AI-driven research and patent intelligence for your innovation.

Short-chain dehydrogenase, coding gene, vector, engineering bacterium and application derived from Refsonia

A technology of short-chain dehydrogenase and Refsonia spp., applied in the field of short-chain dehydrogenase, can solve the problems of low activity of short-chain dehydrogenase/reductase, limitation of large-scale preparation and application, etc.

Active Publication Date: 2015-12-23
艾吉泰康(嘉兴)生物科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the activity of wild-type short-chain dehydrogenase / reductase is low, which limits its large-scale preparation and application. Therefore, the construction of genetically engineered bacteria with high expression activity of short-chain dehydrogenase / reductase has practical application significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Short-chain dehydrogenase, coding gene, vector, engineering bacterium and application derived from Refsonia
  • Short-chain dehydrogenase, coding gene, vector, engineering bacterium and application derived from Refsonia
  • Short-chain dehydrogenase, coding gene, vector, engineering bacterium and application derived from Refsonia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Short-chain dehydrogenase and coding gene derived from Refsonia

[0058] The total genomic DNA of the LeifsoniaxyliHS0904 strain was extracted with a nucleic acid extraction kit (AxygenCo.) (this strain has been protected as a new strain in the Chinese invention patent ZL201010523043.X and preserved in the Chinese Type Culture Collection Center, address: China, Wuhan, Wuhan University, preservation number CCTCCM2010241, preservation date: September 21, 2010), using the genomic DNA as a template, under the action of primer 1 (ATGGCNCARTAYGAYGTNGC) and primer 2 (YYAYTGNGCNGTRTAKCCYCC) PCR amplification.

[0059] Addition amount of each component of the PCR reaction system (total volume 50 μL): PfuDNA Polymerasemix 25 μL, cloning primer 1 and primer 2 each 3 μL (100 μM), genomic DNA 1 μL, nucleic acid-free water 18 μL. Biorad PCR instrument was used to amplify, and the PCR reaction conditions were: pre-denaturation at 95°C for 5min, then temperature cycle at 95...

Embodiment 2

[0060] Embodiment 2: Vector and recombinant genetically engineered bacteria

[0061] Expression primers 3 and 4 were designed according to the analysis results of Example 1, and NcoI and HindIII restriction enzyme sites were introduced into primers 3 and 4, respectively. In primer 3( CCATGG CGCAGTACGACGTGG, the underlined part is the NcoI restriction site, the italic part is the protected base) and primer 4 ( AAGCTT CTATTGTGCTGTGTAGCCTC, the underlined part is the HindIII restriction site, and the italic part is the protective base), under the triggering of high-fidelity Pyrobest DNA polymerase, a short-chain dehydrogenase gene fragment (SEQ ID NO.1) with a length of 756bp was obtained. After sequencing, use NcoI and HindIII restriction enzymes to treat the amplified fragment, and use T4 DNA ligase to connect the fragment with the expression vector pET28a(+) treated with the same restriction enzyme to construct the expression vector pET28a (+)-SDR, pET28a(+)-SDR recombi...

Embodiment 3

[0063] The recombinant Escherichia coli BL21 / pET28a(+)-SDR containing the expression recombinant plasmid pET28a(+)-SDR verified in Example 2 was used at 37°C and 200rpm in LB liquid medium containing 50 μg / mL kanamycin Shake culture for 12 hours, then inoculate into fresh LB liquid medium containing 50 μg / mL kanamycin with a volume concentration of 1% inoculum, and cultivate at 37°C and 200 rpm to a cell concentration of OD 600 0.6-0.9, then add isopropyl-B-D-thiogalactopyranoside (IPTG) with a final concentration of 0.1mM to the culture medium, place at 30°C, 200rpm for 10h, centrifuge at 4°C, 10000rpm for 10min , collect the thalline, wash the thalline twice with physiological saline, and collect the wet thalline (ie, whole cells of the recombinant bacteria).

[0064] (R)-3,5-bistrifluoromethylphenethanol is prepared by using wet bacteria as the enzyme source for transformation and using 3,5-bistrifluoromethylacetophenone as the substrate for the transformation reaction. Tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
optical purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a leifsonia xyli HSO904-based short chain dehydrogenase, and an encoding gene, a carrier, engineering bacteria and application thereof. A gene of the leifsonia xyli HSO904-based short chain dehydrogenase has more than 90% of homology of a nucleotide sequence shown in SEQ ID NO. 1. A colon bacillus BL21 / pET28a (+)-SDR prepared by the recombination of the short chain dehydrogenase is used as an enzyme source, 3, 5-bis-trifluoro methyl acetophenone, trifluoromethyl acetophenone, 4-hydroxyl-2-butanone, acetoacetic ester, 4-chloro ethyl acetoacetate, acetoacetic acid tert-butyl acetate and the like are used as substrates to prepare corresponding chiral compounds such as (R)-3, 5-bis-trifluoromethyl phenethyl alcohol, trifluoromethyl benzaldehyde ethanol, 2-hydroxyl-butyl alcohol, 3-hydroxy ethyl butyrate, 4-chloro-3-hydroxy ethyl butyrate and 3-hydroxy butyric acid tert-butyl acetate through a catalytic asymmetric reduction reaction.

Description

(1) Technical field [0001] The present invention relates to a short-chain dehydrogenase, in particular to a short-chain dehydrogenase gene derived from LeifsoniaxyliHS0904 strain, an enzyme, a recombinant expression vector, a genetically engineered bacterium, and its preparation of chiral Alcohol application. (2) Background technology [0002] Short-chain dehydrogenases / reductases are widely found in plants, animals and microorganisms. Short-chain dehydrogenases / reductases (short-chaindehydrogenases / reductases, SDR) can catalyze such as 3,5-bistrifluoromethylacetophenone, p-trifluoromethylacetophenone, 4-hydroxy-2-butanone , ethyl acetoacetate, ethyl 4-chloroacetoacetate and tert-butyl acetoacetate, etc. to obtain the corresponding (R)-3,5-bistrifluoromethylphenylethanol, p-trifluoromethylbenzene Chiral compounds such as ethanol, 2-hydroxy-butanol, ethyl 3-hydroxybutyrate, ethyl 4-chloro-3-hydroxybutyrate and tert-butyl 3-hydroxybutyrate, these chiral compounds are used in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/04C12N15/63C12N1/21C12N15/70C12P7/22C12P7/18C12P7/62C12R1/01
Inventor 王普王能强黄金
Owner 艾吉泰康(嘉兴)生物科技有限公司