Recombinant escherichia coli capable of producing phosphatidase C, phosphatidase C preparation method, and applications of phosphatidase C

A technology for recombining Escherichia coli and phospholipase, applied in the field of bioengineering, can solve the problems of waste water and saponin polluting the environment, large oil loss and energy consumption, black smoke and the like, and achieves easy process amplification, low cost and good safety. Effect

Active Publication Date: 2014-01-15
JIANGNAN UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In vegetable oil refining, it is necessary to remove the phospholipids in crude oil (that is, degumming). If degumming is not carried out, the oil will turn black and produce black smoke when heated to a certain temperature. The traditional degumming process uses alkali chemical method , that is, NaOH is added to crude oil to convert phospholipids into fatty acid sodium, and then removed by centrifugation. This method has a large oil loss and energy consumption, and the waste water and saponins pollute the environment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli capable of producing phosphatidase C, phosphatidase C preparation method, and applications of phosphatidase C
  • Recombinant escherichia coli capable of producing phosphatidase C, phosphatidase C preparation method, and applications of phosphatidase C

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Cloning of embodiment 1 phospholipase C gene

[0040] According to the sequence design primer of the phospholipase C gene (NC_017911.1) of Pseudomonas fluorescens A506 provided on NCBI, wherein,

[0041] Upstream primer 5'CG GAATTC ATGTCAGGTCTTGAACTCGC3', (the underline is the EcoRI restriction site); downstream primer 5'TT GCGGCCGC TTAGTTGGCGGGTTGGTTTGGC3', (the underline is the Not I restriction site).

[0042] Using the genomic DNA of Pseudomonas fluorescens (Pseudomonas fluorescens) with the preservation number CCTCC No. M2013298 as a template, the phospholipase C gene was cloned by PCR, and connected with the vector pMD18T-simple to construct the cloning vector pMD-plc. The cloning vector was transformed into Escherichia coli competent cell E.coli JM109, and positive clones were selected and verified by sequencing. The base sequence thereof was shown in SEQ ID NO: 1, and the result indicated that the phospholipase C gene was successfully cloned. Blast sequence ...

Embodiment 2

[0043] Construction of embodiment 2 plasmid pET-P.f-PLC

[0044] The recombinant vector pMD-plc and the expression vector pET-28a(+) were double-digested with EcoR I and Not I. The digestion reaction system was 10 μL: pET-28a(+) μL, 0.5 μL each of EcoR I and Not I, EcoR I and Not I share 1 μL of Buffer. The target gene and carrier DNA were recovered and ligated with T4 DNA ligase. The ligation reaction system was 10 μL: 5 μL of target gene, 3 μL of carrier DNA, 10×T4 ligase buffer 1 μL, T4 DNA ligase 1 μL, and reacted at 16°C for 12 hours.

[0045] Transform the ligation product into Escherichia coli competent cells E.coli JM109, the transformation method is as follows:

[0046] (1) Take 100 μL of E.coli JM109 and place it in a sterile 1.5ml EP tube;

[0047] (2) Add the above ligation product and mix gently;

[0048] (3) Put the above-mentioned EP tube in a constant temperature water bath at 42°C, time it for 1.5 minutes, and do not shake the EP tube;

[0049] (4) Transfe...

Embodiment 3

[0053] Example 3 Construction of recombinant Escherichia coli Eschierichia coil BL21(DE3)-pET-P.f-PLC, CCTCC No.M2013299

[0054] The constructed recombinant plasmid pET-plc was transformed into Escherichia coli BL21(DE3), and the transformation method was as follows:

[0055] (1) Take 100 μL of E.coli BL21 (DE3) and place it in a sterile 1.5ml EP tube;

[0056] (2) Add the above-mentioned recombinant plasmid pET-plc and mix gently;

[0057] (3) Place the above EP tube in a constant temperature water bath at 42°C, accurately time it for 1.5 minutes, and do not shake the EP tube;

[0058] (4) Transfer the EP tube to an ice bath and cool for 2 minutes;

[0059] (5) Add 800 μL of sterile LB medium to each tube, and place in a 37°C incubator for recovery for 1 hour;

[0060] (6) Centrifuge at 8000r / min for 2min, suck off 800μL of supernatant medium, gently blow and suck the remaining medium and cells with a pipette gun, and transfer to LB solid plate with a final concentration ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant escherichia coli capable of producing phosphatidase C, a phosphatidase C preparation method, and applications of phosphatidase C. A construction method of the recombinant escherichia coli comprises following steps: A, preparation of phosphatidase C gene, wherein PCR primers are designed, and phosphatidase C gene segments are amplified; B, construction of recombinant plasmids, wherein phosphatidase C gene segments with 1158bp are obtained by digestion using EcoR I and Not I enzymes, and the phosphatidase C gene segments are combined with high-copy plasmid pET28a by clone so as to obtain recombinant plasmid Pet28a-P.f-PLC; and C construction of engineering bacteria, wherein plasmid Pet28a-P.f-PLC is transferred into E.coil BL21(DE3) via transformation. Active phosphatidase C can be produced by liquid fermentation, and intracellular and extracellular enzyme activities can reach 408.5U / ml. Phosphatidase C possesses an application prospect in the fields such as oil and fat refining, phosphatide modification and medical treatment.

Description

technical field [0001] The invention belongs to the field of bioengineering, and in particular relates to a phospholipase C-producing Escherichia coli, and also relates to a preparation method of a phospholipase C-producing Escherichia coli and the phospholipase C produced by fermentation of the engineering bacteria in vegetable oil degumming, etc. Applications. Background technique [0002] Phospholipase C (PLC,: EC3.1.4.3) is a hydrolase that specifically hydrolyzes the phosphatidyl ester bond at the Sn-3 position of natural phospholipids. It plays the role of a second messenger in the life activities of organisms and is widely distributed in bacteria, In yeast, slime mold, fruit fly, frog and various mammals, it can be used in the fields of medicine, feed improvement and food industry. In terms of medicine, it is used to develop anti-platelet aggregation drugs to prevent thrombosis and cardiovascular and cerebrovascular diseases. In terms of feed improvement, phospholip...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N9/16C12N15/55C11B3/00C11B3/04C12R1/19
Inventor常明梁丽刘睿杰金青哲王兴国刘元法
OwnerJIANGNAN UNIV