Biological production method of tanshinol

A production method and technology for Danshensu are applied in the field of biomedicine, and can solve the problems of unstable content, large loss of phenolic components, and high ethanol concentration

Active Publication Date: 2014-03-26
TIANJIN UNIV
View PDF2 Cites 48 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the disadvantage is that the concentration of ethanol is too high, so that the main active danshensu and other phenolic components in the original plant will lose a lot, and the content will be unstable.
But so far there is no literature report on the use of recombinant microorganisms to synthesize Danshensu

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological production method of tanshinol
  • Biological production method of tanshinol
  • Biological production method of tanshinol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Screening of high-yield L-tyrosine strains

[0024] The Escherichia coli BW25113 obtained from the exchange with Japan (acquired by the National Institute of Genetics of Japan through gift or exchange in February 2009, the contact information of the provider is Yada 1111, Mishima, Shizuoka Prefecture 411-8540, Japan) Bacterial strains were subjected to (ultraviolet) mutagenesis culture in LB medium (10g / l NaCl, 10g / l peptone, 5g / l yeast extract), and candidate strains were isolated and fermented to detect L-tyrosine production.

[0025] Transfer 50uL of the preserved candidate strain to a test tube containing 5mL of pH=7.0 LB medium (and add the corresponding antibiotic: ampicillin 100ug / ml), culture at 37°C and 220rmp for 12h, and then transfer 500ul of the overnight cultured candidate strain to Transfer to 250mL shake flask containing 50ml pH=7.0 LB medium (and add corresponding antibiotic: ampicillin 100ug / ml), culture at 37°C, 220rmp. When OD0.6-0.8, add ...

Embodiment 2

[0027] Example 2 Sequence acquisition of p-hydroxyphenylacetic acid meta-hydroxylase (hpaB, hpaC) and construction of pCDF-hpaBC Based on the p-hydroxyphenylacetic acid meta-hydroxylase (hpaB, hpaC) gene sequence of Escherichia coli BL21 (DE3) strain , design primers, and clone (that is, the gene sequence of p-hydroxyphenylacetic acid meta-hydroxylase provided by Escherichia coli BL21 (DE3) strain). Since the realization of the function of p-hydroxyphenylacetic acid meta-hydroxylase requires the completion of two genes, hpaB and hpaC, in the BL21 (DE3) genome, hpaB and hpaC genes are adjacent, so they are cloned and expressed together . The Escherichia coli BL21 (DE3) was provided by Beijing Quanshijin Biotechnology Co., Ltd., on the fourth floor of Building B-3, Zhongguancun Dongsheng Science and Technology Park, No. 66 Xixiaokou Road, Haidian District, Beijing. The gene sequence of p-hydroxyphenylacetic acid meta-hydroxylase (hpaB, hpaC) is shown in SEQ ID No.1 in the seque...

Embodiment 3

[0030] Example 3D-Lactate dehydrogenase (D-LCH) sequence acquisition and construction of pCDF-hpaBC-D-LCH expression vector

[0031] Using the D-LCH gene sequence of Lactobacillus plantarum (Lactobacillus plantarum) ATCC14917 as a reference, PCR primers were designed, and Lactobacillus plantarum CICC21419 (purchased at China Common Microorganism Culture Collection Management Center, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing ) genome as a template for PCR reaction, and cloned into the pJET1.2 vector, sent for sequencing. Then ligated to the constructed pCDF-hpaBC vector to finally obtain an expression plasmid pCDF-hpaBC-D-LCH. The D-LCH gene sequence obtained by sequencing is shown in the sequence table SEQ ID NO.4, and the designed primers are as follows:

[0032] D-LCH-U (up), as shown in the sequence listing SEQ ID NO.5: GGGAATTC CATATG AAAATTATTGCCTATGCTGTAC (the underlined part is the NdeI restriction site); D-LCH-D (down), as shown in the sequence ta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biological production method of tanshinol, which comprises the following steps: synthesizing p-hydroxyphenylpyruvic acid into 3,4-dihydroxyphenylpyruvic acid under the catalytic action of a p-hydroxyphenylacetic acid meta-position hydroxylation enzyme, and then, synthesizing to obtain the tanshinol under the catalytic action of a D-lactate dehydrogenase; or synthesizing p-hydroxyphenylpyruvic acid into p-hydroxyphenyllactic acid under the catalytic action of a D-lactate dehydrogenase, and then, synthesizing to obtain the tanshinol under the catalytic action of a p-hydroxyphenylacetic acid meta-position hydroxylation enzyme. According to the invention, gene engineering glutamic acid corynebacteria and Escherichia coli are used to produce the tanshinol through fermentation, and the tanshinol can be synthesized without adding a substrate, thereby realizing de novo synthesis of the tanshinol and solving the problem on the source of the tanshinol; and meanwhile, the production cost is lowered to the greatest extent. Thus, the biological production method is beneficial to industrial production.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to a production method of danshensu, in particular to a biological production method of danshensu. Background technique [0002] Danshensu (Salvianic acid A, Danshensu), belongs to acidic aromatic compounds, its chemical name is β-(3,4-dihydroxyphenyl) lactic acid, also known as Danshensu A, and its molecular formula is C 9 h 10 o 5 , the molecular weight is 198.17. It is mostly brown-yellow powder or yellow powder, and the pure product is white long needle-like crystal, with a melting point of 84-86°C and a density of 1.546. Recent pharmacological and pharmacodynamic studies have shown that Danshensu can inhibit platelet synthesis, aggregation and release of vasoconstrictor substances such as TXA2, improve myocardial hypoxia resistance, protect the myocardium, and increase coronary flow. These pharmacological effects are the main mechanism of Danshen injection in treating cor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/42C12N15/70C12N1/21C12R1/19
Inventor赵广荣姚元锋赵莹王长松
OwnerTIANJIN UNIV