Method for detecting mutation on locus deltaF508 of CFTR (Cystic Fibrosis Transmembrane Regulator) gene and oligonucleotide

An oligonucleotide and site mutation technology is applied in the field of oligonucleotides for highly sensitive detection of CFTR gene ΔF508 site mutations, which can solve the problems of complex labeling process, false positives, and poor specificity, and reduce costs. The interference of the bottom signal, good accuracy and specificity, and the effect of improving the detection sensitivity

Active Publication Date: 2014-05-14
广州艾迪康医学检验所有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, SYBR Green I is not as specific as the double-hybrid probe method and Taqman probe method because it is an unsaturated dye, and its specificity must be judged by observing the melting curve. In addition, it cannot recognize a specific double-stranded DNA sequence, as long as it is double-stranded DNA The sequence will be combined with luminescence, so the background is usually high, and false positives may occur when used clinically
The two-hybridization probe method involves two specific probes that are complementary to the template and adjacent (distance 1-5bp), the 3' end of the upstream probe is labeled with a donor fluorophore, and the 5' end of the adjacent downstream probe is End-labeled Red640 acceptor fluorophore, the cost is relatively expensive
The molecular beacon method involves a stem-loop double-labeled oligonucleotide probe in a hairpin structure. The nucleic acid sequences at both ends of the probe are complementary paired, and a fluorescent group labeled at one end is labeled with a quencher group at the other end. The biggest disadvantage of this method is that the probe cannot be completely combined with the template during hybridization, so the stability is poor, and the labeling process is more complicated when the probe is synthesized.
The Taqman probe method involves a gene-specific probe (usually 20-30bp long) complementary to the template. The 5' end and the 3' end of the probe are respectively labeled with a reporter fluorophore and a quencher fluorophore, but The longer probe sequence in this method makes the distance between the reporter fluorophore and the quencher fluorophore at both ends of the probe farther away, resulting in incomplete fluorescence quenching, and the quencher group will also produce fluorescence of different wavelengths. This will make the background higher

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting mutation on locus deltaF508 of CFTR (Cystic Fibrosis Transmembrane Regulator) gene and oligonucleotide
  • Method for detecting mutation on locus deltaF508 of CFTR (Cystic Fibrosis Transmembrane Regulator) gene and oligonucleotide
  • Method for detecting mutation on locus deltaF508 of CFTR (Cystic Fibrosis Transmembrane Regulator) gene and oligonucleotide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] An oligonucleotide for detecting the mutation of the CFTR gene ΔF508 site in a sample, the oligonucleotide comprising:

[0051] (1) A pair of specific amplification products SEQ NO1 and SEQ NO2, the base sequence of which is:

[0052] SEQ NO 1: TGGAGCCTTCAGAGGGTAAA

[0053] SEQ NO2: TGGGTAGTGTGAAGGGTTCAT

[0054] (2) A pair of specific detection probes SEQ NO3 and SEQ NO4, the base sequence of which is:

[0055] SEQ NO 3: FAM-AGAAAATATCATCTTTGGTGTT-MGB

[0056] SEQ NO4: HEX-AGAAAATATCATCGGTGTTTCCT-MGB

[0057] Among them, MGB is marked at the 3' end of SEQ NO3 and SEQ NO4 to enhance detection specificity.

[0058] A kit for detecting the ΔF508 point mutation of the CFTR gene in a sample, the kit including a sample DNA extraction reagent, erythrocyte lysate, absolute ethanol, qPCR amplification reaction solution, a positive control substance, a negative control substance and a blank control products, as follows:

[0059] 10× red blood cell lysate formula: NH 4 Cl8...

Embodiment 2

[0068] Embodiment 2: detection process

[0069] (1) Blood DNA extraction: Take 500ul whole blood, put it into a 1.5ml centrifuge tube, add 1ml red blood cell lysate. Turn it upside down to make it completely mixed, rotate and pulsate for 15 seconds, and then put it into a centrifuge for centrifugation at 5000rpm for 10min. Pour off the upper layer, and it can be seen that there is a bloody precipitate at the bottom of the centrifuge tube. Add 500ul red blood cell lysate, repeat this lysis step once. Centrifuge at 5000rpm for 5min, and finally suck up all the upper layer with a pipette and discard it, so that the blood-colored precipitate at the bottom of the centrifuge tube no longer has lysate. Mix well with a metal bath at 100°C for 10 minutes, 12000 rpm for 5 minutes, take the supernatant, and obtain the sample DNA solution. When not used immediately, the sample DNA solution was stored at -20°C until use.

[0070] (2) Real-time fluorescent PCR amplification:

[0071] T...

Embodiment 3

[0075] Embodiment 3: Sample detection verification

[0076] 5 clinical samples were selected, numbered 1-5, among which sample No. 1 was a male infertility patient suspected of having the CFTR gene ΔF508 mutation, and samples No. 2-5 were physical examination samples, which were not infertile patients. The implementation steps are as follows:

[0077] (1) Samples 1-5 are peripheral blood, and DNA is extracted according to the blood DNA extraction method described in Example 2.

[0078] (2) According to the real-time fluorescent PCR amplification method described in Example 2, real-time fluorescent PCR (qPCR) detection was carried out to the DNA of No. 1-5 samples, and Sanger sequencing analysis was carried out to the 10th exon of the CFTR gene of these 5 samples at the same time and PCR-SSCP electrophoresis analysis, wherein the PCR-SSCP electrophoresis graph is as follows Figure 8 shown. The results of the three methods are shown in the table below:

[0079]

[0080] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting mutation on the locus deltaF508 of a CFTR (Cystic Fibrosis Transmembrane Regulator) gene and an oligonucleotide, relating to a pair of specific amplification primers SEQ NO 1 and SEQ NO 2 and a pair of specific detection probes SEQ NO 3 and SEQ NO4. The method has the advantages of short detection period, high specificity, high accuracy, high sensitivity, low conditional dependency, low pollution risk and the like, and can be used for assisting in accurately and rapidly diagnosing cystic fibrosis and male infertility.

Description

technical field [0001] The invention belongs to the field of gene mutation detection, and in particular relates to an oligonucleotide and a method for highly sensitive detection of CFTR gene ΔF508 site mutation. Background technique [0002] Cystic fibrosis (CF) is the most common fatal autosomal recessive genetic disease in Caucasians, and its incidence is higher in Western European, Northern European and North American populations, accounting for about 1 / 2500 live births , the incidence rate in Asians is low, about 1 / 100,000. One of the typical clinical manifestations of CF is male patients with congenital absence of bilateral or unilateral vas deferens, resulting in infertility. Congenital absence of the vas deferens (CAVD) is an important cause of posttesticular factor azoospermia and male infertility, and its pathogenesis is related to CF gene mutation and mesonephric duct development defect. [0003] In 1989, Rommens et al positionally cloned and identified the gene ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q2527/107
Inventor徐建成孙翠莲
Owner广州艾迪康医学检验所有限公司