Detection kit for interleukin 6
An interleukin and kit technology, applied in the field of molecular immunology, can solve the problems of out of control and long reaction time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] The preparation of embodiment 1.IL-6 recombinant protein
[0030] The IL-6 coding sequence was obtained from the NCBI database, and the prokaryotic expression vector pET32-IL6 was constructed to induce the expression of IL-6 recombinant antigen. The protein was immunoreactive by Western blot analysis, and a large amount of IL-6 recombinant protein was prepared by purification on a nickel affinity chromatography column. , the protein can be used for the preparation of antibodies.
[0031] 1. Construction of pET28-IL-6 expression vector
[0032] The IL-6 gene was purchased from Wuhan Sanying Biotechnology Co., Ltd., and primers were designed with reference to the IL-6 cDNA sequence:
[0033] IL-6-F: cgggatccccagtacccccaggag (SEQ ID No. 1) and
[0034] IL-6-R: ccgctcgagctacatttgccgaag (SEQ ID No. 2).
[0035] PCR amplification of IL-6 gene, PCR system:
[0036]
[0037] PCR program:
[0038] 94℃10min 1 cycle
[0039] 94°C 30s, 55°C 30s, 72°C 30s 30 cycles
[0040...
Embodiment 2
[0056] Example 2. Preparation and identification of monoclonal antibodies
[0057] 1. Immunization of Balb / c mice
[0058] Select 6-week-old female Balb / c mice with a body weight of about 20 g, and for the first immunization, take the above-mentioned IL-620-50 μg plus Freund's complete adjuvant and inject them subcutaneously at multiple points, and perform the second and third injections on the 14th and 28th days The dosage of the second immunization is the same as above, and intraperitoneal injection with Freund's incomplete adjuvant is added. The immunization is boosted 3 days before the fusion, and the dose is 20-50 μg. After 3 days, the spleen is taken for fusion.
[0059] 2. Steps of Cell Fusion
[0060] Preparation of feeder cell layer: Take a non-immunized Balb / c mouse, 6 weeks old, kill it by pulling the neck, soak it in 75% alcohol for 5 minutes, cut the skin with sterile scissors, expose the peritoneum, inject 6ml with a sterile syringe Pre-cooled culture solution ...
Embodiment 3
[0071] Example 3. Mass production of monoclonal antibodies
[0072] Have 2 monoclonal antibody hybridoma cell lines: take 1×10 7The concentration of cells was injected into the peritoneal cavity of Balb / c mice, and the ascites fluid was collected 10 days later. Monoclonal antibodies are purified by the following steps:
[0073] 1. The collected ascites was centrifuged at 2500 rpm, and the supernatant was taken. Add an equal volume of PBS (pH7.4) and 1 / 2 volume of saturated ammonium sulfate, and let stand at 4°C for 30 minutes;
[0074] 2. Centrifuge at 3000rpm, 4°C for 20min;
[0075] 3. Remove precipitation, add an equal volume of saturated ammonium sulfate to the supernatant, and let it stand for 30 minutes;
[0076] 4. Centrifuge at 3000rpm, 4°C for 20min;
[0077] 5. Take the precipitate, add 5ml normal saline and 5ml saturated ammonium sulfate and let stand for 30min;
[0078] 6. Centrifuge at 3000rpm, 4°C for 20min;
[0079] 7. Add 5ml of normal saline and 5ml of ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| correlation coefficient | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
