Sorb cold-resistant transcription factor PubHLH and application thereof

A technology of transcription factors and transgenic plants, which is applied in bHLH family transcription factors PubHLH, sorrel cold-resistant transcription factors PubHLH and their application fields, can solve the problems of spending a lot of creative labor, reduce agricultural production costs, improve cold resistance, and realize Environmentally friendly effect

Active Publication Date: 2014-09-10
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can be seen that although the identification of bHLH genes is relatively easy, it takes a lot of creative labor to predict the function of bHLH genes in different species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sorb cold-resistant transcription factor PubHLH and application thereof
  • Sorb cold-resistant transcription factor PubHLH and application thereof
  • Sorb cold-resistant transcription factor PubHLH and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1 PubHLH gene cloning and expression analysis

[0029] RNA was extracted from sorbus leaves under low-temperature treatment at 4°C and reverse-transcribed, and the resulting first-strand cDNA was used to amplify the full-length PubHLH gene. Amplified gene PubHLH primer pair is: Forward primer: PubHLH Forward, 5'-TT GCTGCC ATGCTGCCGAGGCTGAACGGTGGTG-3' (SEQ ID NO: 3); reverse primer: PubHLH Reverse, 5'-GG GGTACC CTACACCATGCCATGGAACCCG-3' (SEQ ID NO: 4). The 50 μl reaction system included 100 ng cDNA, 1× buffer (TransStart FastPfu Buffer), 10 mM dNTP, 1U Taq polymerase (TransStart FastPfu DNA Polymerase) (the aforementioned buffer and Taq polymerase were purchased from TRANS), 1.0 μM of the above primers . The PCR reaction was completed on the Roche480 (Applied Biosystem) amplification instrument according to the following procedures: 95°C, 1 minute, denaturation at 95°C for 20 seconds, annealing at 58°C for 20 seconds, extension at 72°C for 60 seconds,...

Embodiment 2

[0031] Example 2 PubHLH Gene Subcellular Localization, Transcription Activation Analysis

[0032] Since the PubHLH gene has a nuclear localization signal (NLS), the present invention utilizes onion epidermis to study the subcellular localization of the PubHLH gene. The entire ORF reading frame of the PubHLH gene was amplified by RT-PCR, and two restriction sites, NcoI and SpeI, were added to the two ends of the amplification primers. Its amplification primer is (forward primer PubHLH-F1: 5'- CCATGG ATGCTGCCGAGGCTGAACGGTGGTG-3' (SEQ ID NO: 11); reverse primer PubHLH-R1: 5'-GG ACTAGT CACCATGCCATGGAACCCGAT CAA-3' (SEQ ID NO: 12), firstly digest the amplified product. At the same time, pCAMBIA1302 was digested with NcoI and SpeI, and the product was recovered and ligated to obtain the pCAMBIA1302-PubHLH-GFP recombinant vector, which was transformed into Agrobacterium EHA105. Agrobacterium infection of onion epidermis is carried out as follows: (1) draw a plate, pick a single ...

Embodiment 3

[0033] Embodiment 3 Plant Transformation Overexpression Vector Construction

[0034] According to the analysis of the multiple cloning site of pMV vector (patent application number 201210258254.4) and the restriction site on the coding region sequence of PubHLH gene, Xhol and KpnI were selected as endonucleases. First, the clone of the PubHLH gene will be used as a template for PCR amplification (amplification primer pair forward primer: PubHLH Forward, 5'-TT GCTGCC ATGCTGCCGAGGCTGAACGGTGGTG-3' (SEQ ID NO: 3); reverse primer: PubHLH Reverse, 5'-GG GGTACC CTACACCATGCCATGGAACCCG-3' (SEQ ID NO: 4), followed by enzyme digestion of the PCR product together with the pMV vector at 37°C, purification and recovery after enzyme digestion for 3-4 hours. The ratio of PubHLH gene to vector pMV in the ligation reaction system is 3:1, the total reaction volume is 10 μl, 10×T4 ligation buffer 1 μl, T4 ligase 1 μl, 16°C for 13-16 hours. The ligation product was transformed into Escherichia ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a sorb cold-resistant transcription factor PubHLH and an application thereof. The nucleotide sequence of sorb bHLH transcription factor gene PubHLH is represented by SEQ ID NO: 1 in a sequence table; 409-2043bp position of the sequence represented by SEQ ID NO: 1 is a coding area of the gene; an amino acid sequence coded by the coding area is represented by SEQ ID NO: 1. A new bHLH gene PubHLH is cloned in the sorb; an agrobacterium-mediated genetic transformation method is used for transforming the gene to tobacco and pear; cold resistance ability of the obtained transgenic plant is obviously improved; biological functional verification shows that the cloned PubHLH gene has cold resistance regulation function. The sorb bHLH transcription factor gene PubHLH provided by the invention can be applied to improvement of plant cold resistance or construction of cold-resistant transgenic plant.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and relates to a PubHLH, a cold-resistant transcription factor of Poncirus trifoliata, and its application, in particular to a bHLH (basic helix-loop-helix, basic helix-loop-helix) family cloned from Poncirus trifoliata The transcription factor PubHLH was introduced into tobacco and pear respectively, and the cold resistance of the obtained transgenic plants was significantly improved. Background technique [0002] Plants are often subjected to a series of environmental stresses, including drought, high temperature, low temperature, salinity, etc. Among them, low temperature is one of the most important factors that affect the growth and yield of crops and limit the geographical distribution of plants. During the long-term evolution process, plants have formed a complex set of mechanisms to cope with and adapt to these abiotic adversities. In the past two decades, scientists at home and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/82C12N1/21C07K14/415A01H5/00
Inventor 张绍铃黄小三靳丛齐开杰
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap