Supercharge Your Innovation With Domain-Expert AI Agents!

Engineering bacteria based on glutamate synthase and implementation method thereof

A small technology of glutamate synthase and glutamate synthase is applied in the field of engineering bacteria based on glutamate synthase, which can solve the problems of low expression and achieve the maintenance of protein activity, protein purity, and stable biology. active effect

Inactive Publication Date: 2014-10-29
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When the concentration of ammonia around the cell is too high, the activity of glutamate synthase will be inhibited. In addition, glutamate synthase is mostly expressed as an intracellular enzyme in the cell and the expression level is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria based on glutamate synthase and implementation method thereof
  • Engineering bacteria based on glutamate synthase and implementation method thereof
  • Engineering bacteria based on glutamate synthase and implementation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] This embodiment includes the following steps:

[0028] 1) Isolation and cultivation of Streptomyces grisea

[0029] Streptomyces grisea was isolated from rotten straw collected in Pujiang Town, Shanghai, and the preservation number was CGMCC No.5706. The strain was inoculated in LB liquid medium and cultured at 32°C for 48h.

[0030] The above LB liquid medium components are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0‐20.0g / L agar to the liquid medium to obtain LB solid medium.

[0031] 2) Genomic DNA extraction

[0032] Collect 2.0 mL of bacterial liquid and centrifuge at 12000 rpm for 2 min. Discard the supernatant, collect the bacterial pellet, add 180 μL lysozyme (20 mg / mL) and 20 μL EDTA solution (0.5M, pH 8.0), treat at 37 °C for 45 min, add 4 μL RNase A (100 mg / mL), shake and mix for 15 s, Leave it at room temperature for 5 minutes, and then complete the remaining operations according to the operating instructions of the bacter...

Embodiment 2

[0054] Glutamate synthase expression vector construction

[0055] 1) According to the sequence of the large subunit and small subunit of glutamate synthase, design primers containing restriction sites, the sequence is as follows:

[0056] GF‐Nde I‐F:GTACATATGTACGACCCCCCGCAACGAGCACGAC

[0057] GF‐EcoR V‐R:GGAATTCTCA ATGATGATGATGATGATG GCCATTGATCGCCGCCT

[0058] GG‐Nco I‐F:ACCATGGCAGATCCCAAGGGTTTCCTCACCAC

[0059] GG‐EcoR I‐R:CGATATCTCA ATGATGATGATGATGATG GACGGTCATGGGCCGGT

[0060] 2) Using Streptomyces griseorubens genomic DNA as a template, use primers containing Nco I and EcoR I restriction sites for PCR amplification to obtain the glutamic acid synthase small subunit gene sequence, using DNA A‐Tailing Add A to Kit and connect to T‐Vector PMD TM 19‐T (TaKaRa), and the ligation product was transferred into DH5α E. coli. Select positive clones on the ampicillin (50 μg / mL) resistance plate, and shake the bacteria to extract the plasmid and sequence it. Then Nco I and Ec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to engineering bacteria based on glutamate synthase and an implementation method thereof in the technical field of genetic engineering. The implementation method disclosed by the invention comprises the following steps of: taking a streptomyces griseorubens genome DNA as a template, and carrying out PCR (Polymerase Chain Reaction) amplification with a primer containing an enzyme cutting site to obtain coded nucleotide sequences of glutamate synthase small subunit and large subunit in sequence; then, sequentially connecting the gene sequences obtained by amplifying to an expression vector pETDuet-1, thereby finally obtaining a recombination expression vector pETDuet-GG-GF; and converting the glutamate synthase expression vector into an escherichia coli expression strain. According to the invention, aiming at the disadvantages of being seriously limited in application range and effect and the like because most of glutamate synthase is intracellular enzyme in living bodies and the expression quantity is lower in the prior art, in-vitro mass expression synthesis is realized by using genetic engineering means; and furthermore, protein purification in the later period is convenient by adding polyhistidine tags in recombinant protein.

Description

technical field [0001] The invention relates to a gene in the technical field of biological genetic engineering and its engineering strain, in particular to a glutamic acid synthase-based engineering strain of Streptomyces grisea and its realization method. Background technique [0002] Nitrogen is one of the most important nutrients in the process of plant growth and development. At present, the main method to maintain or increase crop yield is to apply a large amount of fertilizer. However, the extensive application of nitrogen fertilizer not only increases the production cost of farmers, but also aggravates the eutrophication of water bodies and the emission of greenhouse gases. [0003] For crops, the ability to absorb and assimilate NO 3 - , NH 4 + and ammonia N and other nitrogen forms, but generally NO 3 - as the main source of nitrogen. NO 3 - When nitrogen source is used, nitrogen assimilation can be divided into three stages: (1) inorganic assimilation of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N9/10C12N15/70C12R1/19
Inventor 周培冯海玮孙玉静支月娥毛亮唐冬卫星罗艳青
Owner SHANGHAI JIAO TONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More